Study on the Role of Short Peptide LCKLSL Targeting ANXA2 in Retinal Neovascularization

Materials and Methods

Ethical approval for this study was granted by the Animal Welfare and Ethics Committee of Hunan Aier Eye Institute (Approval No. AEI20230010). All experimental procedures involving animals were performed in strict accordance with the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health and ARRIVE guidelines.

Mouse model of OIR. The C57BL/6J mice used in this study were provided by Hunan SJA Laboratory Animal Co., Ltd. (Changsha, Hunan, PR China) and were housed and managed in a specific pathogen-free isolation environment at the Experimental Animal Center of Aier Eye Institute. All animal experiments were approved by the Animal Welfare and Ethics Committee of Hunan Aier Eye Institute. To establish the OIR mouse model, postnatal day 7 (P7) mice were randomly divided into a control group, OIR group, low-, medium-, and high-concentration LCKLSL intervention groups (1.25 μg/ml, 2.5 μg/ml, 5 μg/ml), with 8 mice in each group. To induce the OIR model, P7 mice and their lactating mothers were placed in a hyperoxic chamber (YCP-160D, Huaxi Electronic Technology Co., Ltd., Changsha, Hunan, PR China) containing 75% oxygen for 5 days until P12, after which they were returned to a normal oxygen environment for 5 days until P17. The control group was maintained in a normal oxygen environment throughout. All mice were euthanized at P17 via CO₂ inhalation: CO₂ was injected into the euthanasia chamber at a rate of 10% to 30% of the container volume per minute (5.8 l/min), and death was confirmed when breathing stopped and pupils were fully dilated, after which tissue collection for experiments was performed.

LCKLSL administration. LCKLSL (TP2482; Target Mol, Boston, MA, USA) was dissolved in dimethyl sulfoxide (DMSO) to 10 mM and stored at 4°C. For in vivo experiments, LCKLSL was dissolved in phosphate-buffered saline (PBS) to the required concentrations (1.25 μg/ml, 2.5 μg/ml, 5 μg/ml) with DMSO <0.1% and administered via a single 1-μl intravitreal injection into the eyes of mice at P12. For in vitro experiments, LCKLSL was diluted to 2.5 μM, 5 μM, 10 μM, and 20 μM in culture medium with DMSO <0.1% for cell culture and experiments. Mice we anesthetized with an intraperitoneal injection of 30 mg/kg of 0.8% pentobarbital. After confirming that the mice were fully anesthetized, subsequent experiments were conducted.

Retinal flat mount and immunofluorescence staining. Immediately after enucleation, eyeballs were fixed in 4% paraformaldehyde solution at room temperature for 2 h. Under a stereomicroscope, the retina was isolated by making a circumferential incision along the posterior margin of the corneoscleral limbus with micro-ophthalmic scissors and carefully separating it from the choroid. The isolated retina was treated with 5% bovine serum albumin (BSA) containing 0.1% Triton-100 at room temperature for 90 min. After removing the blocking solution, the retina was washed three times with PBS (pH 7.4) for 10 min each, then transferred to a working solution of the vascular-specific marker isolectin B4 (IB4; B1205; 1:200; Vector Laboratories, Burlingame, CA, USA) and incubated at 4°C in the dark for 12 h. After washing three times with PBS for 10 min each, the retina was incubated with streptavidin-conjugated horseradish peroxidase (SA-5594; 1:500; Vector Laboratories) at room temperature in the dark for 2 h, followed by three 10-min PBS washes. It was then transferred to a diluted working solution of ANXA2 primary antibody (11256-1-AP; 1:400; Proteintech Group, Rosemont, IL, USA) and incubated at 4°C in the dark for 12 h. After removing the primary antibody and washing three times with PBS for 10 min each, the retina was incubated with goat anti-rabbit secondary antibody (A-11008; 1:500; Thermo Fisher Scientific, Waltham, MA, USA) at room temperature in the dark for 2 h. After final PBS washes, the retina was carefully flattened on a slide under a stereomicroscope, mounted with anti-fluorescence quenching mounting medium, and covered with a coverslip. Images were acquired using a confocal microscope (LSM880; Zeiss, Oberkochen, Germany) for three-dimensional analysis, and the total retinal area, non-perfusion area, and RNV area were measured with Image J software (National Institutes of Health, Bethesda, MD, USA) to calculate the percentages of non-perfusion area (non-perfusion area/total retinal area × 100%) and RNV area (RNV area/total retinal area × 100%).

Paraffin sections and Hematoxylin/Eosin (HE) staining. For paraffin sections, eyeballs, liver, and kidney tissues were fixed in neutral buffered formalin for 24 h, trimmed with a sharp blade to ensure flat sections, and placed in tissue embedding molds. After washing in tap water for 20 min, tissues were dehydrated, cleared, and embedded in paraffin using an automatic dehydrator: 75% alcohol for 2 h, 85% alcohol for 2 h, 95% alcohol twice, absolute ethanol twice, xylene twice, and melted paraffin twice. Tissues were embedded in cooled paraffin molds, positioned with the optic nerve perpendicular to the mold bottom, solidified at −20°C, and trimmed to obtain wax blocks. Serial 2 μm sections were cut, expanded on a 42°C water bath, mounted on anti-slip slides, dried at 60°C for 30-60 min, and stored at room temperature. For HE staining, sections were dewaxed, hydrated through descending ethanol concentrations (100% to 50%, 5 min each), and washed with running water for 1 min. They were stained with hematoxylin for 4 min, rinsed with tap water for 2 min, subjected to differentiation with 0.8% HCl-ethanol for 2 s, washed again, stained with alcoholic eosin for 20 s, dehydrated through 95% ethanol and absolute ethanol, cleared, mounted, and examined under a microscope.

Electroretinography (ERG). Retinal function was evaluated using dark-adapted ERG. Mice were dark-adapted for at least 10 h before the experiment, with all procedures performed under dim red light. Anesthesia was induced by intraperitoneal injection of 30 mg/kg 0.8% pentobarbital, followed by pupil dilation with 1% tropicamide and corneal surface anesthesia with 0.5% proparacaine eye drops. ERG was recorded using a Ganzfeld Q450 SC electrophysiology system (Roland Consult, Brandenburg, Germany), with a gold corneal contact electrode coupled with sodium hyaluronate, and aluminum reference and ground electrodes implanted subcutaneously in the nape and lateral trunk. Dark-adapted ERG was performed with a 9-level light intensity sequence (0.0003-3.0 cd·s/m²), averaging three waveforms per intensity, filtered at 0.3 Hz (high pass) and 500 Hz (low pass). a-wave amplitude was measured from baseline to trough, with latency from stimulus onset to trough; b-wave amplitude was measured from a-wave trough to b-wave peak, with latency to peak. Pupil dilation and ocular irritation were assessed post-experiment, with data analysis focusing on 3.0 cd·s/m².

Cell culture. HUVECs (Pricella Biotechnology Co., Ltd., Wuhan, Hubei, China) and HRMECs (Pricella Biotechnology Co., Ltd.) were cultured in endothelial cell medium (ECM) containing 10% fetal bovine serum (FBS), 1% endothelial cell growth supplement, and 1% penicillin/streptomycin, in a 37°C, 5% CO₂ incubator with medium changed every 2-3 days. When cells reached 80%-90% confluence, they were passaged with 0.25% trypsin-EDTA. Experiments used cells at passages 3-5, which exhibit stable proliferative and functional properties.

CCK8 assay. HUVECs at 1×10⁵ cells/ml were seeded in 96-well plates (100 μl/well), incubated at 37°C with 5% CO₂ until 80%-90% confluent. Groups included control group (no cells), normoxia group, hypoxia group, and LCKLSL treatment groups of four concentrations (2.5, 5, 10, and 20 μM, 5 replicates for each group). Treatment groups received 200 μl of different concentrations of LCKLSL dissolved in medium, while control groups received equal volume medium. Hypoxia and treatment groups were cultured in a hypoxic chamber for 24, 48, and 72 h, while normoxia and blank groups were in a regular incubator. After removing the medium, 10% CCK8 (HY-K0301; MedChemExpress, Monmouth Junction, NJ, USA) dissolved in medium was added (100 μl/well), and plates were incubated for 1.5 h at 37°C. Absorbance at 450 nm was measured with a microplate reader, and cell proliferation rate was calculated as [(OD experimental − OD blank mean)/(OD control − OD blank mean)] × 100%.

TUNEL assay. HUVECs were divided into control and LCKLSL-treated groups. When cells reached 80%-90% confluence, the culture medium was removed, and cells were washed three times with PBS. The LCKLSL-treated group was incubated with LCKLSL dissolved in culture medium to a final concentration of 10 μM for 24 h, while the control group remained untreated. After 24 h, the medium was discarded and cells were washed again with PBS, then cells were fixed with 4% paraformaldehyde at room temperature for 20 min, washed three times with PBS (5 min each), and incubated with TUNEL reaction mixture (C1086; Beyotime Biotechnology, Shanghai, PR China) in a humidified chamber at 37°C in the dark for 60 min, with negative controls using TdT enzyme-deficient solution. After washing three times with PBS, nuclei were stained with 4′,6-Diamidino-2-phenylindole (DAPI), followed by additional PBS rinses. Specimens were mounted with anti-fluorescence quenching mounting medium and stored in the dark before fluorescence microscopy, where apoptotic cells showed green fluorescence and DAPI-stained nuclei showed blue fluorescence.

Wound healing assay. HUVECs at 5×10⁵ cells/ml were seeded in 12-well plates (100 μl/well), incubated at 37°C with 5% CO₂ until 90% confluent. A 200μL sterile pipette tip was applied along the longitudinal axis of the wells to create linear injury zones with consistent width, followed by three gentle PBS buffer washes to remove detached cells. Three groups (normoxic, hypoxic, and LCKLSL-treated) were established with triplicate wells each. The intervention group received LCKLSL dissolved in serum-free medium to a final concentration of 10 μM, while control groups received equivalent volumes of serum-free medium. All groups were transferred to culture incubators with corresponding gas conditions. Cell migration at wound edges was periodically observed under microscopy, and images captured using a microscopic imaging system. Image J (National Institutes of Health) was employed for wound boundary identification and analysis. Healing rate was calculated using the formula: Healing rate (%) = [(Initial wound width − Measured width at time points)/Initial wound width] × 100%.

Transwell assay. HUVECs were trypsinized, resuspended in serum-free medium at 1×10⁵ cells/ml, and 200 μl was added to the upper chamber of Transwell inserts (CLS4395; Corning, NY, USA), with 600 μl 10% FBS medium in the lower chamber. After grouping (3 replicates per group), hypoxia and LCKLSL intervention groups (LCKLSL was dissolved in culture medium to a final concentration of 10 μM) were cultured in a hypoxic chamber for 24 h, while normoxia groups were in a regular incubator. Non-migrated cells were removed with a sterile swab, and migrated cells were fixed with 4% paraformaldehyde for 15 min, stained with 0.1% crystal violet for 20 min, rinsed, dried, and imaged for counting.

Tube formation assay. HUVECs were starved in serum-free medium for 12 h before the experiment, with Matrigel pre-cooled at 4°C. Matrigel was added to 96-well plates, solidified at 37°C for 30 min, and 1×10⁵ cells were seeded per well. After grouping (3 replicates per group), hypoxia and LCKLSL intervention groups (LCKLSL was dissolved in culture medium to a final concentration of 10 μM) were cultured in a hypoxic chamber for 7 h, while normoxia groups were in a regular incubator. Tube formation was imaged and analyzed for length and branch number using Image J (National Institutes of Health).

LCKLSL FITC conjugation and cellular immunofluorescence staining. FITC was conjugated to LCKLSL using an FITC Conjugation Kit (ab102884; Abcam, Cambridge, UK): 1 μl modifier reagent was added per 10 μl antibody, mixed, and pipetted onto lyophilized FITC conjugation mix, resuspended twice, incubated at room temperature in the dark for 3 h, and quenched with 1 μl quencher reagent per 10 μl antibody. For cellular immunofluorescence, 90% confluent cells were washed with cold PBS, fixed with 4% paraformaldehyde for 20 min, permeabilized and blocked with 0.5% Triton X-100 and 5% BSA for 1.5 h, and incubated with ANXA2 primary antibody (1:500) at 4°C overnight. After washing, cells were incubated with goat anti-rabbit secondary antibody (1:500) at room temperature in the dark for 1.5 h, followed by FITC-conjugated LCKLSL (1:200) at 4°C overnight. After DAPI staining and washing, specimens were mounted and imaged with a confocal laser scanning microscope.

Immunohistochemistry. Paraffin sections were dewaxed, then hydrated through ethanol (100%→95%→75%, 5 min each), and rinsed with deionized water. Antigen retrieval was performed by boiling in pH 6.0 citrate buffer, high-pressure treatment for 2 min, microwaving for 3 min, cooled for 1 h and rinsed with distilled water. Endogenous peroxydases were blocked with 3% H₂O₂ for 30 min, and detection areas were outlined with a pen. Sections were blocked with 10% serum, incubated with primary antibody at 4°C for 16 h, washed, incubated with enzyme-labeled secondary antibody at 37°C for 45 min. Following 3,3′-diaminobenzidine development, sections were counterstained, rinsed, and mounted for microscopy.

Cell-surface tPA elution and ELISA detection. HRMECs were divided into normoxic, hypoxic, hypoxic + VEGF (with concentrations 5, 10, or 20 ng/ml), and LCKLSL-treated (LCKLSL dissolved in culture medium to a final concentration of 10 μM) groups, each group with triplicate wells. The hypoxic, hypoxic + VEGF, and LCKLSL-treated groups were cultured under hypoxic conditions for 24 h, then HRMECs were washed with cold PBS, treated with 0.5 mM EDTA/PBS (no Ca²⁺) at 37°C for 10 min, detached by pipetting, centrifuged at 300×g for 5 min, and supernatants were collected. tPA was detected using an ELISA kit (EK0897; Boster Biological Technology, Wuhan, Hubei, PR China). The experimental procedures were performed according to the manufacturer’s instructions, summarized as follows: pre-coated ELISA plate strips were removed, and 100 μl of standards or test samples were added to each well. The plate was sealed with adhesive film and incubated at 37°C in the dark for 60 min. After incubation, the supernatant was discarded, and washing was conducted using a wash buffer containing 0.1% Tween 20, 300 μl of wash buffer was added to each well, incubated for 1 min at room temperature, and then the liquid was completely removed. This washing procedure was repeated 3 to 5 times. Following washing, 100 μl of HRP-conjugated detection antibody (excluding blank wells) was added to each well. The plate was resealed and incubated at 37°C for another 60 min. After the second incubation, the same washing protocol was repeated 5 times. Subsequently, 100 μl of freshly prepared 3,3′,5,5′-tetramethylbenzidine substrate mixture (A and B components mixed at 1:1 v/v ratio) was added to each well, and the plate was incubated at 37°C in the dark for 10-15 min until a distinct gradient of blue color developed. The reaction was terminated immediately by adding 50 μl of stop solution per well. The optical density (OD) at the primary wavelength of 450 nm was measured using a microplate reader (Synergy™ HTX; BioTek Instruments, Winooski, VT, USA) within 15 min. Target analyte concentrations were calculated by fitting a standard curve. Throughout the procedure, precautions were taken to avoid bubble formation, cross-contamination, and light-induced denaturation of substrates. During washing, consistent volumes of wash buffer were ensured for all wells, and residual liquids were thoroughly tapped out to minimize non-specific adsorption.

Real-time polymerase chain reaction. The isolated intact retinas were immediately transferred to pre-chilled RNase-free EP tubes, and total RNA was extracted following the manufacturer’s instructions of the RNA extraction kit (AG21023; Accurate Biology, Changsha, Hunan, PR China), reverse-transcribed to cDNA with a reverse transcription kit (R223-01; Vazyme, Nanjing, Jiangsu, PR China), and qRT-PCR was performed with ChamQ Universal SYBR qPCR Master Mix (Q711-02; Vazyme) using primers designed from NCBI sequences. The primer sequences used in the study are listed below: ACTIN-forward: AAGGAGCCCACAGAAAAT, ACTIN-reverse: ACCGAACTTGCATTGACATTG; ANXA2-forward: GCAGA GGAACCCGACAGAC, ANXA2-reverse: CAACGCGAAGAA TCCACTCCA; VEGF-forward: AGGGCAATCACGAATTCAC GAAGT, VEGF-reverse: AGGGTCGTCGATTGGATGGCA; MMP2-forward: TCGGAAATGGGACAGACTACT, MMP2-reverse: TCAAAAGGGTCACATTGGTC.

Protein extraction and western blotting analyses. Freshly isolated mouse retinal tissues were immediately snap-frozen in liquid nitrogen and stored at −80°C in centrifuge tubes. For protein extraction, tissues were minced in ice-cold lysis buffer containing protease inhibitors and subjected to intermittent ultrasonic disruption (5-s pulses with cooling intervals to prevent overheating) until achieving a homogeneous lysate. The lysate was centrifuged at 12,000 rpm (14,500 × g) for 15 min at 4°C, and the supernatant was transferred to pre-chilled tubes for temporary storage at −20°C. For protein quantification, a standard curve was prepared using six BSA concentrations (0-10 μg/ml) diluted in ultrapure water. A 50:1 mixture of BCA reagents A/B was added to both standards and samples (in triplicate), followed by 30 min incubation at 37°C. Absorbance at 562 nm was measured, and protein concentrations were calculated using quadratic regression. Samples were normalized with lysis buffer, mixed 4:1 with SDS-PAGE loading buffer, and denatured at 99°C for 4 min before storage at −20°C. For electrophoresis, equal protein amounts (20-50 μg) were loaded into polyacrylamide gel wells alongside molecular weight markers. Separation was performed using a vertical electrophoresis system: initial voltage at 80 V until the tracking dye reached the gel interface, then increased to 120 V until the dye front approached 0.5 cm from the gel bottom. Then, proteins were transferred to nitrocellulose membranes at 220 mA for 90 min using a layered assembly of filter pads, gel, membrane, and buffer-soaked filter papers. Post-transfer, membranes were washed with tris-buffered saline with tween 20 (TBST) (3 × 10 min), blocked with 5% BSA for 1 h at room temperature, and incubated overnight at 4°C with primary antibodies (ANXA2, 11256-1-AP, 1:2,000, Proteintech; VEGF, 19003-1-AP, 1:2,000, Proteintech; MMP2, ab92536, 1:1,500, Merck, Whitehouse Station, NJ, USA; ACTIN, ARG62346, 1:2,000, Arigo, Hsinchu City, Taiwan, ROC) diluted in specific buffer. After TBST washes, membranes were incubated with species-matched secondary antibodies (2 h, 20-25°C with gentle agitation) (goat anti-rabbit, 926-68071, 1:3,000, Licor, Lincoln, NE, USA; goat anti-mouse, ARG65350, 1:3,000, Arigo). Following additional TBST washes, fluorescent signals were captured using a chemiluminescence detection system (G:BOX ChemiXT4; Syngene, Cambridge, UK). Band intensities were quantified via Image J (National Institutes of Health), normalized to β-actin expression, and expressed as relative protein abundance.

Statistical analysis. Data are presented as mean±standard deviation (SD). Statistical significance was determined using Student’s t-test for two groups with normal distribution and homogeneous variance, one-way ANOVA for multiple groups with one factor, and two-way ANOVA for multiple groups with two factors. Image J software (National Institutes of Health) was used for image processing, and GraphPad Prism Software (version 10.2.3 for Windows, GraphPad Software, San Diego, CA, USA, www.graphpad.com) for data analysis, with each experiment repeated at least three times independently.