Research ArticleExperimental Studies
Open Access

Retinoic Acid-inducible Gene-I Increases Interferon-stimulated Gene 15 Expression in Human Renal Proximal Tubule Epithelial Cells

MAYUKI TACHIZAKI, SHOGO KAWAGUCHI, HIROSHI TANAKA and TADAATSU IMAIZUMI
In Vivo May 2026, 40 (3) 1357-1367; DOI: https://doi.org/10.21873/invivo.14288

Abstract

Background/Aim: Viral infections in the kidney activate innate immunity via double-stranded RNA (dsRNA) sensors such as retinoic acid-inducible gene-I (RIG-I). This induces the expression of interferons and interferon-stimulated genes (ISGs), including ISG15. Similarly to ubiquitin, ISG15 functions by binding to target proteins and exerting antiviral effects through ISGylation. ISG15 is secreted extracellularly and exerts antiviral effects. Ubiquitin-like modifier-activating enzyme 7 (UBA7) initiates ISGylation, whereas ubiquitin-specific protease 18 (USP18) removes ISG15 from conjugated proteins. Both RIG-I and ISG15 are involved in antiviral responses and renal fibrosis. However, their interaction during kidney inflammation remains unclear.

Materials and Methods: Primary human renal proximal tubule epithelial cells (hRPTECs) were stimulated with polyinosinic polycytidylic acid [poly(I:C)] to mimic viral dsRNA. The mRNA and protein levels were analyzed using RT-qPCR, western blotting, or ELISA.

Results: Poly(I:C) upregulated the mRNA and protein expression of RIG-I, ISG15, UBA7, and USP18. RIG-I, ISG15, and UBA7 levels increased over time, whereas USP18 levels decreased rapidly. UBA7 knockdown reduced ISGylation, whereas USP18 knockdown enhanced it. Silencing RIG-I decreased ISG15 conjugates, extracellular ISG15, and protein levels of UBA7 and USP18.

Conclusion: RIG-I promotes ISGylation by modulating UBA7, USP18, and ISG15 in renal proximal tubule epithelial cells. RIG-I may help maintain ISGylation homeostasis by balancing the activity of these molecules and preventing the excessive accumulation of free ISG15 or ISGylated proteins. These findings highlight the dual role of RIG-I in antiviral defense and its potential contribution to renal fibrosis, thereby providing insights into therapeutic strategies to balance immunity and kidney protection.

Keywords:

Introduction

Viral kidney infections are commonly observed in immunocompromised patients. When viral infection occurs in cells, viral-derived double-stranded RNA (dsRNA) is detected by pattern recognition receptors, such as endosomal Toll-like receptor (TLR) 3 and cytoplasmic retinoic acid-inducible gene-I (RIG-I), triggering innate immune responses (1). This triggers the production of interferons (IFN) and the subsequent induction of IFN-stimulated genes (ISGs) and inflammatory cytokines. Although ISGs and cytokines defend against the virus (2-4), excessive inflammation can cause acute kidney injury (AKI), progression of AKI to chronic kidney disease (CKD), and worsening of CKD to renal failure (5, 6). If not treated properly, CKD may lead to the need for dialysis, which can have a significant impact on the quality of life of patients.

One of the most well-known ISGs, ISG15 uses a system similar to ubiquitin to bind to target proteins (7). The ubiquitin-like modifier-activating enzyme 7 (UBA7; an E1 activating enzyme) initiates ISGylation by activating ISG15. Ubiquitin-specific protease 18 (USP18) acts as a deISGylating enzyme that removes ISG15 from conjugated proteins. Our previous study on mesangial cells demonstrated that the TLR3 signaling pathway induces the expression of ISG15 and that UBA7 and USP18 are involved in ISGylation (8). ISG15 has been reported to suppress cytomegalovirus replication, a representative virus infecting the kidneys (9). ISG15 suppresses viral replication by ISGylated proteins even during other viral infections (10, 11). In addition, ISG15 is secreted extracellularly and acts as a cytokine (7). Extracellular ISG15 secretion is also suggested to inhibit viral replication (12, 13). However, ISG15 is also reported to promote renal fibrosis by ISGylating transforming growth factor β receptor 1 (TGFβR1), accelerating AKI to CKD transition (14).

As a cytoplasmic RNA sensor, RIG-I initiates innate antiviral immune responses during early viral infection (15, 16). In contrast, RIG-I expression has been associated with renal fibrosis (17, 18). In addition, RIG-I is closely associated with ISG15. For example, RIG-I promotes ISGylation to regulate myeloid differentiation (19) and undergoes autophagic degradation upon binding to ISG15 (20). However, how RIG-I and ISG15 interact during kidney inflammation remains unclear.

Therefore, this study aimed to elucidate the role of RIG-I in ISG15 regulation during viral infection in the kidneys. Primary human renal proximal tubule epithelial cells (hRPTECs) were cultured and simulated by adding polyinosinic polycytidylic acid (poly(I:C)), a synthetic dsRNA, to the culture medium.

Materials and Methods

Cell culture. hRPTECs (Lonza, Walkersville, MD, USA) were maintained at 37°C under 5% CO2. Cells were grown using REGM Bullet Kit (Lonza). As reported previously (3), hRPTECs retain the characteristics of renal proximal tubule epithelial cells. To induce an antiviral-like response, poly(I:C) (P9582; Sigma-Aldrich, St. Louis, MO, USA) was added directly to the culture medium.

Small interfering RNA (siRNA) transfection. For RNA interference experiments, the cells were cultivated in antibiotic-free medium in 6-well plates. Transfection was performed using Lipofectamine RNAiMAX (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacture’s protocol. siRNAs targeting RIG-I (SI03019646; Qiagen, Hilden, Germany; and S223616; Thermo Fisher Scientific), UBA7 (SI03055269; Qiagen), USP18 (SI00118041; Qiagen), or a non-targeting negative control (1027281; Qiagen) were introduced at 25 pmol per well. Following transfection, cells were incubated for 48 h before stimulation with poly(I:C).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR). The total RNA was isolated from cells with NucleoSpin RNA Kit (Macherney-Nagel, Düren, Germany). Single-stranded complementary DNA was synthesized from purified total RNA using random primers (TAKARA BIO, Kusatsu, Japan), dNTP mix (Thermo Fisher Scientific), and M-MLV reverse transcriptase (Thermo Fisher Scientific). RT-qPCR for RIG-I, ISG15, UBA7, USP18, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was performed on the CFX real-time PCR detection system (Bio-Rad, Hercules, CA, USA) using specific primers and SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). GAPDH served as the internal reference gene. Expression levels were calculated as fold changes relative to non-stimulated controls. Primers were obtained from Fasmac (Atsugi, Japan). Primer sequences were as follows:

  • RIG-I-F: 5′- GTGCAAAGCCTTGGCATGT -3′,

  • RIG-I-R: 5′- TGGCTTGGGATGTGGTCTACTC -3′,

  • ISG15-F: 5′- GGCTGGGACCTGACGGTGAAG -3′,

  • ISG15-R: 5′- GCTCCGCCCGCCAGGCTCTGT -3′,

  • UBA7-F: 5′- AGGTGGCCAAGAACTTGGTT -3′,

  • UBA7-R: 5′- CACCACCTGGAAGTCCAACA -3′,

  • USP18-F: 5′- CCCACAGGCTCATAACTAAAGG -3′,

  • USP18-R: 5′- AATATGTAACCATGAGGCCCC -3′,

  • GAPDH-F: 5′- GCACCGTCAAGGCTGAGAAC -3′, and

  • GAPDH-R: 5′- ATGGTGGTGAAGACGCCAGT -3′.

Western blotting. The cells were lysed using Laemmli sample buffer and collected by scraping. Proteins were separated using e-PAGEL gels (ATTO, Tokyo, Japan) and transferred onto polyvinylidene difluoride membranes (Merck Millipore, Darmstadt, Germany). The membranes were blocked at room temperature for 2 h in Tris-buffered saline containing 5% skim milk, followed by overnight incubation at 4°C with primary antibodies. After washing, the membranes were incubated with horseradish peroxidase-labeled anti-rabbit or mouse IgG antibody (Medical and Biological Laboratories, Nagoya, Japan) at room temperature for 1 h. Signals were detected using Luminata Crescendo substrate (Merck Millipore). The primary antibodies used are as follows:

Rabbit anti-RIG-I [1:10,000; described in (21)]; mouse anti-ISG15 (1:1,000; sc-166755; Santa Cruz Biotechnology, Santa Cruz, CA, USA); rabbit anti-UBA7 (1:1,000; TA307362; OriGene, Rockville, MD, USA); rabbit anti-USP18 (1:1,000; 4813S; Cell Signaling Technologies, Danvers, MA, USA); and rabbit anti-actin (1:3,000; A5060; Sigma Aldrich).

Statistical analysis. RT-qPCR data are presented as mean ± standard deviation (SD). Comparisons among three groups were performed using one-way analysis of variance (ANOVA) followed by Dunnett’s post hoc test. For comparisons between two groups, Student’s t-test was applied. p<0.05 was considered statistically significant.

Results

Poly(I:C) stimulation induced the expression of RIG-I, ISG15, UBA7, and USP18 in hRPTECs. The expression of RIG-I, ISG15, UBA7, and USP18 in hRPTECs following stimulation with poly(I:C) was investigated. The expression levels of RIG-I, UBA7, and USP18 mRNA (Figure 1A) and proteins (Figure 1B) increased in a concentration-dependent manner. Similarly, ISG15 mRNA (Figure 1A), free ISG15 protein (Figure 1B), ISG15 conjugates (Figure 1B), and extracellular ISG15 (Figure 1C) were up-regulated in a concentration-dependent manner. The time course of expression was investigated for up to 48 h after poly(I:C) stimulation. RIG-I, ISG15, and USP18 mRNA expression levels peaked at 8 h and then decreased (Figure 2A), whereas that of UBA7 mRNA peaked at 8 h and remained elevated thereafter (Figure 2A). UBA7 was constitutively expressed, even in the absence of stimulation (Figure 2B). The levels of RIG-I, free ISG15, UBA7, and USP18 proteins peaked between 8 h and 24 h (Figure 2B). Subsequently, RIG-I, free ISG15, and UBA7 protein levels persisted for up to 48 h, whereas USP18 protein levels decreased after 48 h (Figure 2B). Expression of ISG15 conjugates was detected at 16 h and continued to increase until 48 h (Figure 2B). Extracellular ISG15 was detected at 24 h and 48 h (Figure 2C).

Figure 1.
Figure 1.

Retinoic acid-inducible gene-I (RIG-I), interferon-stimulated gene 15 (ISG15), ubiquitin-like modifier-activating enzyme 7 (UBA7), and ubiquitin-specific protease 18 (USP18) were induced in a concentration-dependent manner by poly(I:C). Cells were stimulated with 0-50 μg/ml poly(I:C) for 24 h. Total RNA was extracted from the cells and used to analyze mRNA levels of RIG-I, ISG15, UBA7, USP18, and GAPDH using RT-qPCR (A). Cells were lysed, and western blotting was used to analyze expression levels of RIG-I, ISG15, UBA7, USP18, and actin proteins (B). Cell culture medium was collected, and extracellular ISG15 expression was analyzed using ELISA (C). Data in (A) and (C) are presented as mean±SD of triplicate values.

Figure 2.
Figure 2.

Time course of RIG-I, ISG15, UBA7, and USP18 expression after treatment of human renal proximal tubule epithelial cells (hRPTECs) with poly(I:C). (A, B) The cells were treated with poly(I:C) (10 μg/ml) for 2, 4, 8, 16, 24, and 48 h. RIG-I, ISG15, UBA7, USP18, and GAPDH mRNA expression levels were analyzed by RT-qPCR using total RNA extracted from cells (A). After cell lysis, western blotting was used to analyze the cell lysates for RIG-I, ISG15, UBA7, USP18, and actin protein expression (B). (C) Cells were treated with poly(I:C) (10 μg/ml), and cell culture medium was collected after 24 h and 48 h. Extracellular ISG15 protein was analyzed using ELISA (C). Data in (A) and (C) are presented as mean±SD of triplicate values.

UBA7 and USP18 were associated with ISGylation in hRPTECs. We investigated whether UBA7, an enzyme that promotes ISGylation, and USP18, an enzyme that removes ISGylation, are involved in ISGylation in hRPTECs. The cells were transfected with UBA7 siRNA or USP18 siRNA, and knockdown of UBA7 and USP18 was effective at both the mRNA (Figure 3A) and protein (Figure 3B) levels. UBA7 knockdown increased the levels of free ISG15 and decreased those of ISG15 conjugates (Figure 3B). Conversely, USP18 knockdown decreased the expression of free ISG15 whereas increased that of ISG15 conjugates (Figure 3B).

Figure 3.
Figure 3.

UBA7 and USP18 enzymes were involved in ISGylation. Cultured cells were transfected with either a control siRNA or siRNAs targeting UBA7 or USP18 and incubated for 2 days. The cells were then stimulated with poly(I:C) (10 μg/ml). After incubating for16 h, total RNA was extracted, and UBA7, USP18, and GAPDH expression levels were analyzed using RT-qPCR (A). After 24 h of incubation, the cells were lysed, and western blotting was used to analyze the lysates for UBA7, USP18, and actin levels (B). Data in (A) is presented as mean±SD of triplicate values. *p<0.05, relative to cells transfected with control siRNA using the Student’s t-test.

RIG-I up-regulated the expression of ISG15, UBA7, and USP18 in hRPTECs. To evaluate the effect of RIG-I on ISG15 expression, cells were transfected with two different RIG-I siRNAs before stimulation with poly(I:C). Transfection with RIG-I siRNA effectively reduced the RIG-I mRNA (Figure 4A) and protein (Figure 4B) levels. Transfection with RIG-I siRNA-2 slightly increased ISG15 mRNA levels, whereas transfection with RIG-I siRNA-1 did not affect ISG15 mRNA levels (Figure 4A). This difference in results may be because of off-target effects of the siRNA. RIG-I knockdown reduced the expression of ISG15 conjugates (Figure 4B), whereas the expression of free ISG15 showed only a slight decrease. A marked decrease in extracellular ISG15 protein levels was detected after poly(I:C) stimulation following RIG-I knockdown (Figure 4C).

Figure 4.
Figure 4.
Figure 4.

RIG-I was involved in poly(I:C)-induced ISG15 conjugate expression levels. Cultured cells were transfected with either a control siRNA or two different siRNAs targeting RIG-I and incubated for 2 days. The cells were then stimulated with poly(I:C) (10 μg/ml). After 4 h of incubation, total RNA was extracted, and RIG-I, ISG15, UBA7, USP18, and GAPDH expression levels were analyzed using RT-qPCR (A). After 24 h of incubation, the cells were lysed, and western blotting was used to analyze the lysates for RIG-I, ISG15, UBA7, USP18, and actin levels (B). After 48 h of incubation, the cell culture medium was collected, and extracellular ISG15 expression was analyzed using ELISA (C). Data in (A) and (C) are presented as mean±SD of triplicate values. *p<0.05, relative to cells transfected with control siRNA by ANOVA; n.s. indicates no significant difference.

Next, we investigated whether UBA7 and USP18 were responsible for the reduction in ISG15 expression following RIG-I knockdown. RIG-I knockdown did not affect UBA7 mRNA expression (Figure 4A). Transfection with RIG-I siRNA-1 slightly decreased the expression of USP18 mRNA, whereas transfection with RIG-I siRNA-2 had no effect (Figure 4A). This difference in results may be owing to off-target effects of the siRNA. However, RIG-I knockdown reduced the UBA7 and USP18 protein levels (Figure 4C).

Discussion

The present study demonstrates that poly(I:C) stimulation upregulated the expression of RIG-I, ISG15, UBA7, and USP18 in hRPTECs. UBA7 and USP18 were also shown to be involved in ISGylation and deISGylation in hRPTECs. This indicated that these proteins, which are typically associated with antiviral defense during infection, were also induced in proximal tubule epithelial cells. Silencing of RIG-I reduced the protein expression of ISG15, UBA7, and USP18 without significantly affecting their mRNA expression, suggesting that RIG-I enhanced protein expression through post-transcriptional regulation. Previous reports indicate that RIG-I can bind to the 3′ untranslated region of nuclear factor kappa B1 mRNA, thereby facilitating its translation (22), and may also indirectly regulate programmed death-ligand 1 degradation (23). Thus, RIG-I may promote translation or inhibit protein degradation; however, further detailed investigations are required to clarify these mechanisms.

RIG-I knockdown also decreased the levels of ISG15 conjugates and secreted ISG15. If RIG-I did not influence the levels of total ISG15, the levels of free ISG15 would be expected to increase upon RIG-I silencing; however, this was not observed. These findings suggest that RIG-I increased the levels of not only ISG15 conjugates and extracellular ISG15, but also total ISG15 protein. ISGylation and free ISG15 exert antiviral effects. ISGylation suppresses viral replication by targeting viral proteins and host protein kinases (7, 24). RIG-I knockdown also reduced UBA7 levels, suggesting that RIG-I promotes ISGylation by enhancing UBA7. Free ISG15 promotes natural killer cell proliferation, stimulates IFN-γ production, induces dendritic cell maturation, and acts as a neutrophil chemoattractant when secreted extracellularly (7). The pathway mediating ISG15 secretion remains unclear; no established pathway or mechanism has been identified, and various hypotheses are under consideration (25). One hypothesis suggests that ISG15 is packaged into exosomes during TLR3 activation, indicating that it is secreted by exosomes (26). RIG-I activation may induce the release of extracellular vesicles, thereby increasing ISG15 secretion; however the precise stage at which RIG-I acts requires further elucidation. Collectively, these observations indicated that RIG-I contributes to antiviral defense by increasing ISGylation and ISG15 secretion. Conversely, RIG-I and ISG15 conjugates have been associated with renal fibrosis (14, 17, 18). Thus, persistent RIG-I activation owing to hyperinflammation may drive sustained ISGylation and renal injury. Further studies are required to determine whether feedback mechanisms adequately limit this process.

Notably, although RIG-I increases ISG15 conjugation, it also upregulates USP18, a deISGylating enzyme. ISGylation activates the NLRP3 inflammasome and induces hyperinflammation (27). Thus, RIG-I may balance ISGylation and prevent excess free ISG15 and ISG conjugates by coordinating the regulation of UBA7 and USP18. USP18 decayed more quickly than other ISGs, including RIG-I, ISG15, and UBA7. USP18 is also known to exert a negative regulatory effect on the IFN pathway, preventing excessive inflammation (28). As renal tubule cells are highly susceptible to IFN-induced metabolic stress (29), USP18 expression may play a vital role in protecting the kidneys. However, because USP18 expression over an extended period leads to prolonged viral infection (30), the rapid decay rate of USP18 is understandable from the perspective of viral clearance. Thus, early USP18 attenuation in hRPTECs may confer dual benefits of limiting inflammation while preserving antiviral activity.

Based on these results, the conceptual diagram shown in Figure 5 is proposed. Controlling ISG15, which functions in viral defense and CKD progression, may allow the development of therapeutic strategies to prevent CKD progression while maintaining antiviral activity.

Figure 5.
Figure 5.

Schematic model of RIG-I functions on the regulation of ISG15 expression in human renal proximal tubule epithelial cells (hRPTECs).

Study limitations. First, actual viral infections were not included. Immune responses may vary according to cell type and viral strain. ISG15 function is also virus- and cell type-dependent. Poly(I:C) serves as a surrogate for viral dsRNA, providing a model for innate immune activation rather than actual infection. Although the precise function of RIG-I during actual viral infections remains to be elucidated, the findings of this study provide foundational insights into innate immunity in the renal tubules. Second, the detailed mechanisms by which RIG-I increases ISG15, UBA7, and USP18 protein levels remain unclear. Elucidating these mechanisms may lay the groundwork for developing therapeutic strategies to prevent renal fibrosis while maintaining antiviral defense.

Conclusion

RIG-I amplifies ISGylation and extracellular ISG15 secretion, playing a crucial role in innate immune regulation in renal proximal tubule epithelial cells. By modulating both ISGylation-activating and deISGylating enzymes, RIG-I may maintain ISGylation homeostasis, thereby preventing the excessive activity of free ISG15 and ISG15 conjugates.

Acknowledgements

The Authors thank Nakata M. for the technical assistance and Honyaku Center Inc. for English language editing.

Footnotes

  • Authors’ Contributions

    Mayuki Tachizaki and Tadaatsu Imaizumi were responsible for all the experiments and manuscript preparation. Shogo Kawaguchi contributed to cell culture. Mayuki Tachizaki, Hiroshi Tanaka, and Tadaatsu Imaizumi contributed to the study design. The final manuscript has been read and approved by all Authors.

  • Conflicts of Interest

    The Authors declare no conflicts of interest regarding the research, writing, or publication of this study.

  • Funding

    JSPS KAKENHI Grant Number 22K07862 to HT.

  • Artificial Intelligence (AI) Disclosure

    Language translation and refinement were assisted by DeepL Translator (DeepL SE, Cologne, Germany). All AI-assisted content was reviewed and finalized by the Authors.

  • Received January 14, 2026.
  • Revision received February 6, 2026.
  • Accepted February 9, 2026.

This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

References

  1. ↵
    1. Heutinck KM,
    2. Rowshani AT,
    3. Kassies J,
    4. Claessen N,
    5. van Donselaar-van der Pant KA,
    6. Bemelman FJ,
    7. Eldering E,
    8. van Lier RA,
    9. Florquin S,
    10. Ten Berge IJ,
    11. Hamann J
    : Viral double-stranded RNA sensors induce antiviral, pro-inflammatory, and pro-apoptotic responses in human renal tubular epithelial cells. Kidney Int 82(6): 664-75, 2012. DOI: 10.1038/ki.2012.206
    OpenUrlCrossRefPubMed
  2. ↵
    1. Kawai T,
    2. Akira S
    : Antiviral signaling through pattern recognition receptors. J Biochem 141(2): 137-145, 2006. DOI: 10.1093/jb/mvm032
    OpenUrlCrossRefPubMed
  3. ↵
    1. Tachizaki M,
    2. Sakamoto S,
    3. Kobori Y,
    4. Asano Y,
    5. Kawaguchi S,
    6. Seya K,
    7. Tanaka H,
    8. Morita E,
    9. Imaizumi T
    : Interferon-stimulated gene 56 positively regulates Toll-like receptor 3-mediated CXCL10 expression in human renal proximal tubular epithelial cells. FEBS Open Bio 14(8): 1303-1319, 2024. DOI: 10.1002/2211-5463.13851
    OpenUrlCrossRefPubMed
  4. ↵
    1. Schneider WM,
    2. Chevillotte MD,
    3. Rice CM
    : Interferon-stimulated genes: a complex web of host defenses. Annu Rev Immunol 32: 513-545, 2014. DOI: 10.1146/annurev-immunol-032713-120231
    OpenUrlCrossRefPubMed
  5. ↵
    1. Masset C,
    2. Le Turnier P,
    3. Bressollette-Bodin C,
    4. Renaudin K,
    5. Raffi F,
    6. Dantal J
    : Virus-associated nephropathies: a narrative review. Int J Mol Sci 23(19): 12014, 2022. DOI: 10.3390/ijms231912014
    OpenUrlCrossRefPubMed
  6. ↵
    1. Wang Z,
    2. Zhang C
    : From AKI to CKD: Maladaptive repair and the underlying mechanisms. Int J Mol Sci 23(18): 10880, 2022. DOI: 10.3390/ijms231810880
    OpenUrlCrossRefPubMed
  7. ↵
    1. Freitas BT,
    2. Scholte FEM,
    3. Bergeron É,
    4. Pegan SD
    : How ISG15 combats viral infection. Virus Res 286: 198036, 2020. DOI: 10.1016/j.virusres.2020.198036
    OpenUrlCrossRefPubMed
  8. ↵
    1. Imaizumi T,
    2. Shimada T,
    3. Matsumiya T,
    4. Yoshida H,
    5. Watanabe S,
    6. Tsuruga K,
    7. Kawaguchi S,
    8. Murakami M,
    9. Joh K,
    10. Tanaka H
    : Interferon-stimulated gene 15, a type I interferon-dependent transcript, is involved in a negative feedback loop in innate immune reactions in human mesangial cells. Nephron 132(2): 144-152, 2016. DOI: 10.1159/000443934
    OpenUrlCrossRefPubMed
  9. ↵
    1. Bianco C,
    2. Mohr I
    : Restriction of human cytomegalovirus replication by ISG15, a host effector regulated by cGAS-STING double-stranded-DNA sensing. J Virol 91(9): e02483-16, 2017. DOI: 10.1128/JVI.02483-16
    OpenUrlAbstract/FREE Full Text
  10. ↵
    1. González-Sanz R,
    2. Mata M,
    3. Bermejo-Martín J,
    4. Álvarez A,
    5. Cortijo J,
    6. Melero JA,
    7. Martínez I
    : ISG15 is upregulated in respiratory syncytial virus infection and reduces virus growth through protein ISGylation. J Virol 90(7): 3428-3438, 2016. DOI: 10.1128/JVI.02695-15
    OpenUrlAbstract/FREE Full Text
  11. ↵
    1. Hishiki T,
    2. Han Q,
    3. Arimoto K,
    4. Shimotohno K,
    5. Igarashi T,
    6. Vasudevan SG,
    7. Suzuki Y,
    8. Yamamoto N
    : Interferon-mediated ISG15 conjugation restricts dengue virus 2 replication. Biochem Biophys Res Commun 448(1): 95-100, 2014. DOI: 10.1016/j.bbrc.2014.04.081
    OpenUrlCrossRefPubMed
  12. ↵
    1. Singh PK,
    2. Singh S,
    3. Farr D,
    4. Kumar A
    : Interferon-stimulated gene 15 (ISG15) restricts Zika virus replication in primary human corneal epithelial cells. Ocul Surf 17(3): 551-559, 2019. DOI: 10.1016/j.jtos.2019.03.006
    OpenUrlCrossRefPubMed
  13. ↵
    1. Tang J,
    2. Tang A,
    3. Jia N,
    4. Du H,
    5. Liu C,
    6. Zhu J,
    7. Li C,
    8. Meng C,
    9. Liu G
    : Free ISG15 inhibits the replication of peste des petits ruminants virus by breaking the interaction of nucleoprotein and phosphoprotein. Microbiol Spectr 10(5): e0103122, 2022. DOI: 10.1128/spectrum.01031-22
    OpenUrlCrossRef
  14. ↵
    1. Cui N,
    2. Liu C,
    3. Tang X,
    4. Song L,
    5. Xiao Z,
    6. Wang C,
    7. Wu Y,
    8. Zhou Y,
    9. Peng C,
    10. Liu Y,
    11. Zheng L,
    12. Liu X,
    13. Huang K,
    14. Chen H
    : ISG15 accelerates acute kidney injury and the subsequent AKI-to-CKD transition by promoting TGFβR1 ISGylation. Theranostics 14(11): 4536-4553, 2024. DOI: 10.7150/thno.95796
    OpenUrlCrossRefPubMed
  15. ↵
    1. Matsumoto M,
    2. Oshiumi H,
    3. Seya T
    : Antiviral responses induced by the TLR3 pathway. Rev Med Virol 21(2): 67-77, 2011. DOI: 10.1002/rmv.680
    OpenUrlCrossRefPubMed
  16. ↵
    1. Thoresen D,
    2. Wang W,
    3. Galls D,
    4. Guo R,
    5. Xu L,
    6. Pyle AM
    : The molecular mechanism of RIG-I activation and signaling. Immunol Rev 304(1): 154-168, 2021. DOI: 10.1111/imr.13022
    OpenUrlCrossRefPubMed
  17. ↵
    1. Li LX,
    2. Ji TT,
    3. Lu L,
    4. Li XY,
    5. Lu LM,
    6. Bai SJ
    : [Reduction in RNF125-mediated RIG-I ubiquitination and degradation promotes renal inflammation and fibrosis progression]. Sheng Li Xue Bao 77(3): 385-394, 2025. DOI: 10.13294/j.aps.2025.0028
    OpenUrlCrossRefPubMed
  18. ↵
    1. Zhou Z,
    2. Ni J,
    3. Li J,
    4. Huo C,
    5. Miao N,
    6. Yin F,
    7. Cheng Q,
    8. Xu D,
    9. Xie H,
    10. Chen P,
    11. Zheng P,
    12. Zhang Y,
    13. Zhou L,
    14. Zhang W,
    15. Yu C,
    16. Liu J,
    17. Lu L
    : RIG-I aggravates interstitial fibrosis via c-Myc-mediated fibroblast activation in UUO mice. J Mol Med (Berl) 98(4): 527-540, 2020. DOI: 10.1007/s00109-020-01879-x
    OpenUrlCrossRefPubMed
  19. ↵
    1. Wu SF,
    2. Xia L,
    3. Shi XD,
    4. Dai YJ,
    5. Zhang WN,
    6. Zhao JM,
    7. Zhang W,
    8. Weng XQ,
    9. Lu J,
    10. Le HY,
    11. Tao SC,
    12. Zhu J,
    13. Chen Z,
    14. Wang YY,
    15. Chen S
    : RIG-I regulates myeloid differentiation by promoting TRIM25-mediated ISGylation. Proc Natl Acad Sci U S A 117(25): 14395-14404, 2020. DOI: 10.1073/pnas.1918596117
    OpenUrlAbstract/FREE Full Text
  20. ↵
    1. Du Y,
    2. Duan T,
    3. Feng Y,
    4. Liu Q,
    5. Lin M,
    6. Cui J,
    7. Wang RF
    : LRRC25 inhibits type I IFN signaling by targeting ISG15-associated RIG-I for autophagic degradation. EMBO J 37(3): 351-366, 2018. DOI: 10.15252/embj.201796781
    OpenUrlAbstract/FREE Full Text
  21. ↵
    1. Imaizumi T,
    2. Aratani S,
    3. Nakajima T,
    4. Carlson M,
    5. Matsumiya T,
    6. Tanji K,
    7. Ookawa K,
    8. Yoshida H,
    9. Tsuchida S,
    10. McIntyre TM,
    11. Prescott SM,
    12. Zimmerman GA,
    13. Satoh K
    : Retinoic acid-inducible gene-I is induced in endothelial cells by LPS and regulates expression of COX-2. Biochem Biophys Res Commun 292(1): 274-279, 2002. DOI: 10.1006/bbrc.2002.6650
    OpenUrlCrossRefPubMed
  22. ↵
    1. Zhang HX,
    2. Liu ZX,
    3. Sun YP,
    4. Zhu J,
    5. Lu SY,
    6. Liu XS,
    7. Huang QH,
    8. Xie YY,
    9. Zhu HB,
    10. Dang SY,
    11. Chen HF,
    12. Zheng GY,
    13. Li YX,
    14. Kuang Y,
    15. Fei J,
    16. Chen SJ,
    17. Chen Z,
    18. Wang ZG
    : Rig-I regulates NF-κB activity through binding to Nf-κb1 3′-UTR mRNA. Proc Natl Acad Sci U S A 110(16): 6459-6464, 2013. DOI: 10.1073/pnas.1304432110
    OpenUrlAbstract/FREE Full Text
  23. ↵
    1. Zhang Y,
    2. Zeng L,
    3. Wang M,
    4. Yang Z,
    5. Zhang H,
    6. Gao L,
    7. Zhang R,
    8. Liu J,
    9. Shan W,
    10. Chang Y,
    11. Liu L,
    12. Zhao Q,
    13. Li Y,
    14. Liu J
    : RIG-I promotes immune evasion of colon cancer by modulating PD-L1 ubiquitination. J Immunother Cancer 11(9): e007313, 2023. DOI: 10.1136/jitc-2023-007313
    OpenUrlAbstract/FREE Full Text
  24. ↵
    1. Okumura F,
    2. Okumura AJ,
    3. Uematsu K,
    4. Hatakeyama S,
    5. Zhang DE,
    6. Kamura T
    : Activation of double-stranded RNA-activated protein kinase (PKR) by interferon-stimulated gene 15 (ISG15) modification down-regulates protein translation. J Biol Chem 288(4): 2839-2847, 2013. DOI: 10.1074/jbc.M112.401851
    OpenUrlAbstract/FREE Full Text
  25. ↵
    1. Kang JA,
    2. Kim YJ,
    3. Jeon YJ
    : The diverse repertoire of ISG15: more intricate than initially thought. Exp Mol Med 54(11): 1779-1792, 2022. DOI: 10.1038/s12276-022-00872-3
    OpenUrlCrossRef
  26. ↵
    1. Sun L,
    2. Wang X,
    3. Zhou Y,
    4. Zhou RH,
    5. Ho WZ,
    6. Li JL
    : Exosomes contribute to the transmission of anti-HIV activity from TLR3-activated brain microvascular endothelial cells to macrophages. Antiviral Res 134: 167-171, 2016. DOI: 10.1016/j.antiviral.2016.07.013
    OpenUrlCrossRefPubMed
  27. ↵
    1. Qin Y,
    2. Meng X,
    3. Wang M,
    4. Liang W,
    5. Xu R,
    6. Chen J,
    7. Song H,
    8. Fu Y,
    9. Li J,
    10. Gao C,
    11. Jia M,
    12. Zhao C,
    13. Zhao W
    : Posttranslational ISGylation of NLRP3 by HERC enzymes facilitates inflammasome activation in models of inflammation. J Clin Invest 133(20): e161935, 2023. DOI: 10.1172/JCI161935
    OpenUrlCrossRefPubMed
  28. ↵
    1. Malakhova OA,
    2. Kim KI,
    3. Luo JK,
    4. Zou W,
    5. Kumar KG,
    6. Fuchs SY,
    7. Shuai K,
    8. Zhang DE
    : UBP43 is a novel regulator of interferon signaling independent of its ISG15 isopeptidase activity. EMBO J 25(11): 2358-2367, 2006. DOI: 10.1038/sj.emboj.7601149
    OpenUrlAbstract/FREE Full Text
  29. ↵
    1. Wang Y,
    2. Lan Q,
    3. Li F,
    4. Xiong J,
    5. Xie H,
    6. Gong S,
    7. Yao M,
    8. Lv L,
    9. Qin S,
    10. Xin W,
    11. Zhang A,
    12. Zhou S,
    13. Huang Y,
    14. Zhao J
    : Macrophage-derived type 1 IFN, renal tubular epithelial cell polyploidization, and AKI-to-CKD transition. J Am Soc Nephrol 36(5): 766-780, 2025. DOI: 10.1681/ASN.0000000577
    OpenUrlCrossRefPubMed
  30. ↵
    1. Ye H,
    2. Duan X,
    3. Yao M,
    4. Kang L,
    5. Li Y,
    6. Li S,
    7. Li B,
    8. Chen L
    : USP18 mediates interferon resistance of dengue virus infection. Front Microbiol 12: 682380, 2021. DOI: 10.3389/fmicb.2021.682380
    OpenUrlCrossRef
Back to top

In this issue

Print
Download PDF
Article Alerts
Email Article
Citation Tools
Reprints and Permissions
Retinoic Acid-inducible Gene-I Increases Interferon-stimulated Gene 15 Expression in Human Renal Proximal Tubule Epithelial Cells
MAYUKI TACHIZAKI, SHOGO KAWAGUCHI, HIROSHI TANAKA, TADAATSU IMAIZUMI
In Vivo May 2026, 40 (3) 1357-1367; DOI: 10.21873/invivo.14288
Twitter logo Facebook logo Mendeley logo

Jump to section

Keywords