Skip to main content

Main menu

  • Home
  • Current Issue
  • Archive
  • Info for
    • Authors
    • Editorial Policies
    • Advertisers
    • Editorial Board
    • Special Issues
  • Journal Metrics
  • Other Publications
    • Anticancer Research
    • Cancer Genomics & Proteomics
    • Cancer Diagnosis & Prognosis
  • More
    • IIAR
    • Conferences
  • About Us
    • General Policy
    • Contact
  • Other Publications
    • In Vivo
    • Anticancer Research
    • Cancer Genomics & Proteomics

User menu

  • Register
  • Subscribe
  • My alerts
  • Log in
  • Log out
  • My Cart

Search

  • Advanced search
In Vivo
  • Other Publications
    • In Vivo
    • Anticancer Research
    • Cancer Genomics & Proteomics
  • Register
  • Subscribe
  • My alerts
  • Log in
  • Log out
  • My Cart
In Vivo

Advanced Search

  • Home
  • Current Issue
  • Archive
  • Info for
    • Authors
    • Editorial Policies
    • Advertisers
    • Editorial Board
    • Special Issues
  • Journal Metrics
  • Other Publications
    • Anticancer Research
    • Cancer Genomics & Proteomics
    • Cancer Diagnosis & Prognosis
  • More
    • IIAR
    • Conferences
  • About Us
    • General Policy
    • Contact
  • Visit iiar on Facebook
  • Follow us on Linkedin
Research ArticleExperimental Studies
Open Access

Fusion of the High-mobility Group AT-Hook 2 (HMGA2) and the Gelsolin (GSN) Genes in Lipomas With t(9;12)(q33;q14) Chromosomal Translocation

IOANNIS PANAGOPOULOS, KRISTIN ANDERSEN, MARTA BRUNETTI, LUDMILA GORUNOVA, MARIUS LUND-IVERSEN, FRANCESCA MICCI and SVERRE HEIM
In Vivo March 2023, 37 (2) 524-530; DOI: https://doi.org/10.21873/invivo.13110
IOANNIS PANAGOPOULOS
1Section for Cancer Cytogenetics, Institute for Cancer Genetics and Informatics, The Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: ioannis.panagopoulos{at}rr-research.no
KRISTIN ANDERSEN
1Section for Cancer Cytogenetics, Institute for Cancer Genetics and Informatics, The Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
MARTA BRUNETTI
1Section for Cancer Cytogenetics, Institute for Cancer Genetics and Informatics, The Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
LUDMILA GORUNOVA
1Section for Cancer Cytogenetics, Institute for Cancer Genetics and Informatics, The Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
MARIUS LUND-IVERSEN
2Department of Pathology, The Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
FRANCESCA MICCI
1Section for Cancer Cytogenetics, Institute for Cancer Genetics and Informatics, The Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
SVERRE HEIM
1Section for Cancer Cytogenetics, Institute for Cancer Genetics and Informatics, The Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Abstract

Background/Aim: Lipomas are benign tumors composed of mature fat cells. They are common soft tissue tumors that often carry chromosome aberrations involving 12q14 resulting in rearrangements, deregulation, and generation of chimeras of the high-mobility group AT-hook 2 gene (HMGA2) which maps in 12q14.3. In the present study, we report the finding of t(9;12)(q33;q14) translocation in lipomas and describe its molecular consequences. Materials and Methods: Four lipomas from two male and two female adult patients were selected because their neoplastic cells carried a t(9;12)(q33;q14) as the sole karyotypic aberration. The tumors were investigated using RNA sequencing, reverse transcription polymerase chain reaction (RT-PCR), and Sanger sequencing techniques. Results: RNA sequencing of a t(9;12)(q33;q14)-lipoma detected an in-frame fusion of HMGA2 with the gelsolin gene (GSN) from 9q33. RT-PCR together with Sanger sequencing confirmed the presence of an HMGA2::GSN chimera in the tumor as well as in two other tumors from which RNA was available. The chimera was predicted to code for an HMGA2::GSN protein which would contain the three AT-hook domains of HMGA2 and the entire functional part of GSN. Conclusion: t(9;12)(q33;q14) is a recurrent cytogenetic aberration in lipomas and generates an HMGA2::GSN chimera. Similar to what is seen in other rearrangements of HMGA2 in mesenchymal tumors, the translocation physically separates the part of HMGA2 encoding AT-hook domains from the gene’s 3′-terminal part which contains elements that normally regulate HMGA2 expression.

Key Words:
  • Lipoma
  • chromosomal translocation
  • t(9;12)(q33;q14)
  • high mobility group AT-hook 2 (HMGA2) gene
  • gelsolin gene (GSN)
  • HMGA2::GSN chimera

Lipomas are benign tumors composed of mature fat cells (1, 2). They are common in adults where they may occur both subcutaneously and as deep-seated lesions. Most lipomas are easily diagnosed as such, but those occurring deep down (intramuscular lipoma and perineural lipoma) may be confused with liposarcomas (1, 2).

Cytogenetic examinations of lipomas have shown that they often carry chromosome aberrations involving 12q14 (3-9). These aberrations result in rearrangements involving truncation, deregulation, and generation of chimeras of the high-mobility group AT-hook 2 gene (HMGA2) which is found in chromosome subband 12q14.3 (10-17). The recombination of 12q14 involves a wide variety of partners (8, 9, 16-18). The by-far most common event is the translocation t(3;12)(q28;q14) which fuses HMGA2 with a gene from 3q28 named LIM domain containing preferred translocation partner in lipoma (LPP) (3-11, 19), but also many other genomic recombinations giving rise to HMGA2 chimeric genes have been reported in lipomas (Table I) (10-15, 19-27). In the present study, we describe the specific translocation t(9;12)(q33;q14) and its molecular consequences in four lipomas.

View this table:
  • View inline
  • View popup
  • Download powerpoint
Table I.

Genomic aberrations in lipomas giving rise to the high-mobility group AT-hook 2 (HMGA2) gene (on 12q14) truncation or in-frame fusions (denoted with *).

Materials and Methods

Patients. Table II shows the patient sex, age, diagnosis, and tumor location and size. All tumors were surgically removed. The study was approved by the Regional Ethics Committee (Regional komité for medisinsk forskningsetikk Sør-Øst, Norge). All patient information has been de-identified.

View this table:
  • View inline
  • View popup
  • Download powerpoint
Table II.

Clinical, cytogenetic, and molecular data on the four lipomas.

Methods. All methods used in the present study have been described in many of our previous publications (14, 28-35). In brief, for cytogenetic analysis, samples from the surgical specimens were disaggregated and the resulting cells were cultured, harvested, and processed for cytogenetic examination using standard techniques (36, 37). Chromosome preparations were G-banded with Wright’s stain (Sigma-Aldrich, St Louis, MO, USA) and examined. Metaphases were analyzed and karyograms prepared using the CytoVision computer-assisted karyotyping system (Leica Biosystems, Newcastle upon Tyne, UK). The karyotypes were designated according to the International System for Human Cytogenomic Nomenclature (38). For RNA sequencing and molecular analyses, total RNA from three of the lipomas was isolated from tissue adjacent to that used for cytogenetic analysis and histologic examination using miRNeasy kit, TissueLyser II homogenizer, and Qiacube according to the manufacturer’s recommendations (Qiagen, Hilden, Germany). The RNA quality was evaluated with a 2100 Bioanalyzer system and RNA 6000 Nano Kit (Agilent, Santa Clara, CA, USA). One microgram of total RNA from tumor 4 (Table II) was sent to the Genomics Core Facility at the Norwegian Radium Hospital, Oslo University Hospital, for high-throughput paired-end RNA sequencing. Fusion transcripts were found using the FusionCatcher software (39, 40). For cDNA synthesis, 400-500 ng of total RNA were reverse-transcribed using iScript Advanced cDNA Synthesis Kit for RT-qPCR according to the manufacturer’s instructions (Bio-Rad Laboratories, Hercules, CA, USA). cDNA equivalent to 20 ng/μl of total RNA was used as template in subsequent PCR assays. Outer PCRs were performed using the forward primer HMGA2-845F1 and the reverse primer GSN-337R1 (Table III). Nested (inner) PCRs were performed using the forward primer HMGA2-929F1 and reverse primer GSN-272R1 (Table III). Three μl of the PCR products were stained with GelRed (Biotium, Hayward, CA, USA), analyzed by electrophoresis through 1.0% agarose gel, and photographed. The remaining PCR products were purified with the MinElute PCR Purification Kit (Qiagen) and sequenced using Sanger sequencing methodology on the Applied Biosystems SeqStudio Genetic Analyzer system (ThermoFisher Scientific, Waltham, MA, USA). The Basic Local Alignment Search Tool (BLAST) was used to compare sequences obtained by Sanger sequencing with the NCBI reference sequences NM_003483.4 (HMGA2) and NM_000177.5 (GSN) (41).

View this table:
  • View inline
  • View popup
  • Download powerpoint
Table III.

Designation, sequence (5′->3′), and position in reference sequences of the forward (F) and reverse (R) primers of the high mobility-group AT-hook 2 (HMGA2) and the gelsolin (GSN) genes, used for polymerase chain reaction (PCR) amplification and Sanger sequencing analyses.

Results

All four lipomas had the balanced translocation t(9;12)(q33;q14) as the sole karyotypic aberration (Figure 1, Table II); indeed, the tumors were selected for further studies because their neoplastic cells carried a t(9;12)(q33;q14) chromosome translocation.

Figure 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 1.

G-banding analysis of lipomas. Partial karyograms showing the der(9)t(9;12)(q33;q14) and der(12)t(9;12)(q33;q14) together with the corresponding normal chromosome homologs; breakpoint positions are indicated by arrows.

Analysis using FusionCatcher of RNA sequencing data in the fastq files obtained from tumor 4 detected an HMGA2::GSN chimeric transcript in which exon 3 of HMGA2 was fused in frame with exon 2 of GSN (fusion of nucleotide 1060 in reference sequence with accession number NM_003483.4 with nucleotide 176 in reference sequence NM_000177.5):

AGCCACTGGAGAAAAACGGCCAAGAGGCAGACC TAGGAAATGG::CCCAACAGCATGGTGGTGGAACACC CCGAGTTCCTCAAGGCAG.

Nested RT-PCR with the primer combinations HMGA2-845F1/GSN-337R1 and HMGA2-929F1/GSN-272R1, as well as further Sanger sequencing of the cDNA amplified fragments, verified the above-mentioned HMGA2::GSN chimeric transcript in tumor 4 (Figure 2A and B). The same analysis (nested RT-PCR/Sanger sequencing) detected an identical HMGA2::GSN chimeric transcript in tumors 2 and 3, the only other two tumors from which RNA was available (Table II).

Figure 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 2.

Molecular genetic examination of lipomas. (A) Gel electrophoresis showing the amplified cDNA fragment using the primer combination HMGA2-929F1 and GSN-272R1. (B) Partial Sanger sequencing chromatogram of the amplified fragment showing the junction (vertical line) between exon 3 of HMGA2 and exon 2 of GSN. (C) The chimeric HMGA2::GSN protein. The HMGA2 part is in grey background. The AT-hook domains are shown with red bold letters. The actin-binding, calcium-sensitive area is in yellow background. The gelsolin like domains are shown with green bold letters.

Discussion

We showed that the chromosome translocation t(9;12) (q33;q14) is a recurrent cytogenetic aberration in lipomas leading to fusion of HMGA2 with the GSN gene from 9q33. Because both genes are transcribed from centromere to telomere, the chimeric gene HMGA2::GSN is predicted to be generated on der(12)t(9;12)(q33;q14). The chromosome translocation t(9;12)(q33;q14) was previously reported in a deep-seated lipoma located in the thorax of a 72-year-old woman but that tumor was not subjected to molecular investigations (9). Recently, in an investigation of eleven lipoblastomas using targeted RNA sequencing methodology, the HMGA2::GSN chimera was found in a lipoblastoma located in the lower extremity of a 12-year-old boy (42). The fusion point in that case was identical to the HMGA2::GSN fusion points detected in the present study (42).

Gelsolin is an actin binding and calcium regulated protein which is involved in assembly and disassembly of actin filaments influencing cell morphology, differentiation, movement, and apoptosis (43-45). The GSN gene has many alternative splicing transcripts but in the main encodes two gelsolin isoforms: a 731 amino acid long/80 kDa cytosolic protein (NP_001121134.1) and a plasma 782 amino acid long/86 kDa in weight protein (NP_000168.1) found in the plasma of humans (46-48). Plasma gelsolin has a signal peptide not found in the cytosolic form of the protein (43-48). Depending on the type of neoplasm, gelsolin has been reported to have tumor suppression or oncogenetic function (44, 45).

Based on the reference sequences NM_003483.4/NP_003474.1 for HMGA2 and NM_000177.5/NP_000168.1 for GSN, the HMGA2::GSN chimera is predicted to code for an 817 amino acid long peptide containing amino acid residues 1-83 from HMGA2 protein and 49-782 from GSN protein. Thus, HMGA2::GSN chimeric protein would contain the three AT-hook domains of HMGA2 and the entire functional part of GSN without the signal peptide which is found in the first 27 amino acids of native GSN protein (Figure 2B and C) (48, 49).

Very few HMGA2 fusion genes result in chimeric HMGA2 proteins (17, 33). The HMGA2::LPP chimera found in lipomas, chondroid hamartomas, and chondromas codes for a chimeric HMGA2::LPP protein (10, 11, 19, 50-52). Fusion of HMGA2 with the epidermal growth factor receptor gene (EGFR) from 7p11, reported in a single case of glioblastoma, generates a fusion gene coding for a chimeric HMGA2::EGFR protein (53). An in-frame fusion transcript of HMGA2 with the Yes1-associated transcriptional regulator gene (YAP1) from 11q22 was reported in an aggressive angiomyxoma (54). Recently, fusion of HMGA2 with the nuclear receptor co-repressor 2 gene (NCOR2) from 12q24.31 was described; the result is an HMGA2::NCOR2 chimeric protein found in osteoclastic giant cell-rich tumors of bone (31), giant cell-rich soft-tissue tumors expressing low- to high molecular weight keratins (55), xanthogranulomatous epithelial tumor (56), and tenosynovial giant-cell tumor (57). Tumorigenic properties were detected for both the HMGA2::LPP (58-60) and HMGA2::EGFR fusion proteins (53), whereas functional studies have not been performed to test for the effects of HMGA2::YAP1, HMGA2::NCOR2, and the present HMGA2::GSN chimeric protein. Although the 3′-end partners (LPP, EGFR, YAP1, NCOR2, and GSN) in HMGA2 chimeric proteins are involved in different cell functions and have been implicated in tumor development (33), it is worthy of note that all the above-mentioned HMGA2-chimeras contain the three AT-hook domains of HMGA2 (17, 33). In this sense, the pattern is similar to what is seen in other rearrangements of HMGA2 found in lipomas and other tumors, i.e., disruption of the HMGA2 locus leaves intact exons 1-3 of the gene which encode the AT-hook domains and separates them from the 3′-terminal part of the gene which contains regulatory elements for the expression of HMGA2 (34, 61-63).

In conclusion, in the present study we showed that (9;12)(q33;q14) is a recurrent cytogenetic aberration in lipomas, and that the translocation generates an HMGA2::GSN fusion gene. The resulting fusion protein would contain the three AT-hook domains of HMGA2 and the entire functional part of GSN. In this manner, the part of HMGA2 encoding the AT-hook domains becomes physically separated from the 3′-terminal part of the gene which contains elements that regulate gene expression.

Acknowledgements

This study was supported by grants from Radiumhospitalets Legater.

Footnotes

  • Authors’ Contributions

    IP designed and supervised the research, performed molecular genetic experiments, bioinformatics analysis, and wrote the manuscript. KA performed molecular genetic experiments and interpreted the data. MB performed molecular genetic experiments. LG performed cytogenetic analysis. ML-I performed pathological examination. FM evaluated the data. SH assisted with experimental design and writing of the manuscript. All Authors read and approved of the final manuscript.

  • Conflicts of Interest

    The Authors declare that they have no potential conflicts of interest.

  • Received December 13, 2022.
  • Revision received January 5, 2023.
  • Accepted January 13, 2023.
  • Copyright © 2023 The Author(s). Published by the International Institute of Anticancer Research.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY-NC-ND) 4.0 international license (https://creativecommons.org/licenses/by-nc-nd/4.0).

References

  1. ↵
    1. Charifa A,
    2. Azmat CE and
    3. Badri T
    : Lipoma Pathology. StatPearls [Internet], 2022. PMID: 29493968.
  2. ↵
    1. Kolb L,
    2. Yarrarapu SNS,
    3. Ameer MA and
    4. Rosario-Collazo JA
    : Lipoma. StatPearls [Internet], 2022. PMID: 29939683.
  3. ↵
    1. Heim S,
    2. Mandahl N,
    3. Kristoffersson U,
    4. Mitelman F,
    5. Rööser B,
    6. Rydholm A and
    7. Willén H
    : Reciprocal translocation t(3;12)(q27;q13) in lipoma. Cancer Genet Cytogenet 23(4): 301-304, 1986. PMID: 3779626. DOI: 10.1016/0165-4608(86)90012-9
    OpenUrlCrossRefPubMed
    1. Turc-Carel C,
    2. Dal Cin P,
    3. Rao U,
    4. Karakousis C and
    5. Sandberg AA
    : Cytogenetic studies of adipose tissue tumors. I. A benign lipoma with reciprocal translocation t(3;12)(q28;q14). Cancer Genet Cytogenet 23(4): 283-289, 1986. PMID: 3779624. DOI: 10.1016/0165-4608(86)90010-5
    OpenUrlCrossRefPubMed
    1. Mandahl N,
    2. Heim S,
    3. Johansson B,
    4. Bennet K,
    5. Mertens F,
    6. Olsson G,
    7. Rööser B,
    8. Rydholm A,
    9. Willén H and
    10. Mitelman F
    : Lipomas have characteristic structural chromosomal rearrangements of 12q13-q14. Int J Cancer 39(6): 685-688, 1987. PMID: 3473046. DOI: 10.1002/ijc.2910390605
    OpenUrlCrossRefPubMed
    1. Heim S,
    2. Mandahl N,
    3. Rydholm A,
    4. Willén H and
    5. Mitelman F
    : Different karyotypic features characterize different clinico-pathologic subgroups of benign lipogenic tumors. Int J Cancer 42(6): 863-867, 1988. PMID: 3192332. DOI: 10.1002/ijc.2910420612
    OpenUrlCrossRefPubMed
    1. Mandahl N,
    2. Heim S,
    3. Arheden K,
    4. Rydholm A,
    5. Willén H and
    6. Mitelman F
    : Three major cytogenetic subgroups can be identified among chromosomally abnormal solitary lipomas. Hum Genet 79(3): 203-208, 1988. PMID: 3402992. DOI: 10.1007/BF00366238
    OpenUrlCrossRefPubMed
  4. ↵
    1. Mandahl N,
    2. Höglund M,
    3. Mertens F,
    4. Rydholm A,
    5. Willén H,
    6. Brosjö O and
    7. Mitelman F
    : Cytogenetic aberrations in 188 benign and borderline adipose tissue tumors. Genes Chromosomes Cancer 9(3): 207-215, 1994. PMID: 7515663. DOI: 10.1002/gcc.2870090309
    OpenUrlCrossRefPubMed
  5. ↵
    1. Bartuma H,
    2. Hallor KH,
    3. Panagopoulos I,
    4. Collin A,
    5. Rydholm A,
    6. Gustafson P,
    7. Bauer HC,
    8. Brosjö O,
    9. Domanski HA,
    10. Mandahl N and
    11. Mertens F
    : Assessment of the clinical and molecular impact of different cytogenetic subgroups in a series of 272 lipomas with abnormal karyotype. Genes Chromosomes Cancer 46(6): 594-606, 2007. PMID: 17370328. DOI: 10.1002/gcc.20445
    OpenUrlCrossRefPubMed
  6. ↵
    1. Ashar HR,
    2. Fejzo MS,
    3. Tkachenko A,
    4. Zhou X,
    5. Fletcher JA,
    6. Weremowicz S,
    7. Morton CC and
    8. Chada K
    : Disruption of the architectural factor HMGI-C: DNA-binding AT hook motifs fused in lipomas to distinct transcriptional regulatory domains. Cell 82(1): 57-65, 1995. PMID: 7606786. DOI: 10.1016/0092-8674(95)90052-7
    OpenUrlCrossRefPubMed
  7. ↵
    1. Schoenmakers EF,
    2. Wanschura S,
    3. Mols R,
    4. Bullerdiek J,
    5. Van den Berghe H and
    6. Van de Ven WJ
    : Recurrent rearrangements in the high mobility group protein gene, HMGI-C, in benign mesenchymal tumours. Nat Genet 10(4): 436-444, 1995. PMID: 7670494. DOI: 10.1038/ng0895-436
    OpenUrlCrossRefPubMed
    1. Broberg K,
    2. Zhang M,
    3. Strömbeck B,
    4. Isaksson M,
    5. Nilsson M,
    6. Mertens F,
    7. Mandahl N and
    8. Panagopoulos I
    : Fusion of RDC1 with HMGA2 in lipomas as the result of chromosome aberrations involving 2q35-37 and 12q13-15. Int J Oncol 21(2): 321-326, 2002. PMID: 12118328
    OpenUrlPubMed
    1. Nilsson M,
    2. Mertens F,
    3. Höglund M,
    4. Mandahl N and
    5. Panagopoulos I
    : Truncation and fusion of HMGA2 in lipomas with rearrangements of 5q32—>q33 and 12q14—>q15. Cytogenet Genome Res 112(1-2): 60-66, 2006. PMID: 16276091. DOI: 10.1159/000087514
    OpenUrlCrossRefPubMed
  8. ↵
    1. Panagopoulos I,
    2. Gorunova L,
    3. Bjerkehagen B,
    4. Lobmaier I and
    5. Heim S
    : The recurrent chromosomal translocation t(12;18) (q14∼15;q12∼21) causes the fusion gene HMGA2-SETBP1 and HMGA2 expression in lipoma and osteochondrolipoma. Int J Oncol 47(3): 884-890, 2015. PMID: 26202160. DOI:10.3892/ijo.2015.3099
    OpenUrlCrossRefPubMed
  9. ↵
    1. Agostini A,
    2. Gorunova L,
    3. Bjerkehagen B,
    4. Lobmaier I,
    5. Heim S and
    6. Panagopoulos I
    : Molecular characterization of the t(4;12)(q27∼28;q14∼15) chromosomal rearrangement in lipoma. Oncol Lett 12(3): 1701-1704, 2016. PMID: 27588119. DOI: 10.3892/ol.2016.4834
    OpenUrlCrossRefPubMed
  10. ↵
    1. Unachukwu U,
    2. Chada K and
    3. D’Armiento J
    : High Mobility Group AT-Hook 2 (HMGA2) Oncogenicity in Mesenchymal and Epithelial Neoplasia. Int J Mol Sci 21(9): 3151, 2020. PMID: 32365712. DOI: 10.3390/ijms21093151
    OpenUrlCrossRefPubMed
  11. ↵
    1. Panagopoulos I and
    2. Heim S
    : Neoplasia-associated chromosome translocations resulting in gene truncation. Cancer Genomics Proteomics 19(6): 647-672, 2022. PMID: 36316036. DOI: 10.21873/cgp.20349
    OpenUrlAbstract/FREE Full Text
  12. ↵
    1. Heim S and
    2. Mitelman F
    : Cancer cytogenetics: Chromosomal and molecular genetic abberations of tumor cells. Fourth Edition edn. Wiley-Blackwell, 2015.
  13. ↵
    1. Petit MM,
    2. Mols R,
    3. Schoenmakers EF,
    4. Mandahl N and
    5. Van de Ven WJ
    : LPP, the preferred fusion partner gene of HMGIC in lipomas, is a novel member of the LIM protein gene family. Genomics 36(1): 118-129, 1996. PMID: 8812423. DOI: 10.1006/geno.1996.0432
    OpenUrlCrossRefPubMed
    1. Bianchini L,
    2. Birtwisle L,
    3. Saâda E,
    4. Bazin A,
    5. Long E,
    6. Roussel JF,
    7. Michiels JF,
    8. Forest F,
    9. Dani C,
    10. Myklebost O,
    11. Birtwisle-Peyrottes I and
    12. Pedeutour F
    : Identification of PPAP2B as a novel recurrent translocation partner gene of HMGA2 in lipomas. Genes Chromosomes Cancer 52(6): 580-590, 2013. PMID: 23508853. DOI: 10.1002/gcc.22055
    OpenUrlCrossRefPubMed
    1. Hatano H,
    2. Morita T,
    3. Ogose A,
    4. Hotta T,
    5. Kobayashi H,
    6. Segawa H,
    7. Uchiyama T,
    8. Takenouchi T and
    9. Sato T
    : Clinicopathological features of lipomas with gene fusions involving HMGA2. Anticancer Res 28(1B): 535-538, 2008. PMID: 18383898.
    OpenUrlAbstract/FREE Full Text
    1. Petit MM,
    2. Swarts S,
    3. Bridge JA and
    4. Van de Ven WJ
    : Expression of reciprocal fusion transcripts of the HMGIC and LPP genes in parosteal lipoma. Cancer Genet Cytogenet 106(1): 18-23, 1998. PMID: 9772904. DOI: 10.1016/s0165-4608(98)00038-7
    OpenUrlCrossRefPubMed
    1. Nilsson M,
    2. Panagopoulos I,
    3. Mertens F and
    4. Mandahl N
    : Fusion of the HMGA2 and NFIB genes in lipoma. Virchows Arch 447(5): 855-858, 2005. PMID: 16133369. DOI: 10.1007/s00428-005-0037-9
    OpenUrlCrossRefPubMed
    1. Italiano A,
    2. Ebran N,
    3. Attias R,
    4. Chevallier A,
    5. Monticelli I,
    6. Mainguené C,
    7. Benchimol D and
    8. Pedeutour F
    : NFIB rearrangement in superficial, retroperitoneal, and colonic lipomas with aberrations involving chromosome band 9p22. Genes Chromosomes Cancer 47(11): 971-977, 2008. PMID: 18663748. DOI: 10.1002/gcc.20602
    OpenUrlCrossRefPubMed
    1. Pierron A,
    2. Fernandez C,
    3. Saada E,
    4. Keslair F,
    5. Hery G,
    6. Zattara H and
    7. Pedeutour F
    : HMGA2-NFIB fusion in a pediatric intramuscular lipoma: a novel case of NFIB alteration in a large deep-seated adipocytic tumor. Cancer Genet Cytogenet 195(1): 66-70, 2009. PMID: 19837271. DOI: 10.1016/j.cancergencyto.2009.06.009
    OpenUrlCrossRefPubMed
    1. Lacaria M,
    2. El Demellawy D and
    3. McGowan-Jordan J
    : A rare case of pediatric lipoma with t(9;12)(p22;q14) and evidence of HMGA2-NFIB gene fusion. Cancer Genet 216-217: 100-104, 2017. PMID: 29025583. DOI: 10.1016/j.cancergen.2017.07.011
    OpenUrlCrossRefPubMed
  14. ↵
    1. Petit MM,
    2. Schoenmakers EF,
    3. Huysmans C,
    4. Geurts JM,
    5. Mandahl N and
    6. Van de Ven WJ
    : LHFP, a novel translocation partner gene of HMGIC in a lipoma, is a member of a new family of LHFP-like genes. Genomics 57(3): 438-441, 1999. PMID: 10329012. DOI: 10.1006/geno.1999.5778
    OpenUrlCrossRefPubMed
  15. ↵
    1. Panagopoulos I,
    2. Gorunova L,
    3. Agostini A,
    4. Lobmaier I,
    5. Bjerkehagen B and
    6. Heim S
    : Fusion of the HMGA2 and C9orf92 genes in myolipoma with t(9;12)(p22;q14). Diagn Pathol 11: 22, 2016. PMID: 26857357. DOI: 10.1186/s13000-016-0472-8
    OpenUrlCrossRefPubMed
    1. Panagopoulos I,
    2. Gorunova L,
    3. Lund-Iversen M,
    4. Andersen K,
    5. Andersen HK,
    6. Lobmaier I,
    7. Bjerkehagen B and
    8. Heim S
    : Cytogenetics of spindle cell/pleomorphic lipomas: Karyotyping and FISH analysis of 31 tumors. Cancer Genomics Proteomics 15(3): 193-200, 2018. PMID: 29695401. DOI: 10.21873/cgp.20077
    OpenUrlAbstract/FREE Full Text
    1. Panagopoulos I,
    2. Gorunova L,
    3. Andersen HK,
    4. Pedersen TD,
    5. Lømo J,
    6. Lund-Iversen M,
    7. Micci F and
    8. Heim S
    : Genetic characterization of myoid hamartoma of the breast. Cancer Genomics Proteomics 16(6): 563-568, 2019. PMID: 31659109. DOI: 10.21873/cgp.20158
    OpenUrlAbstract/FREE Full Text
  16. ↵
    1. Panagopoulos I,
    2. Andersen K,
    3. Gorunova L,
    4. Davidson B,
    5. Micci F and
    6. Heim S
    : Fusion of the HMGA2 and BNC2 genes in uterine leiomyoma with t(9;12)(p22;q14). In Vivo 36(6): 2654-2661, 2022. PMID: 36309352. DOI: 10.21873/invivo.13000
    OpenUrlAbstract/FREE Full Text
    1. Panagopoulos I,
    2. Andersen K,
    3. Gorunova L,
    4. Eilert-Olsen M,
    5. Lund-Iversen M,
    6. Wessel-Aas T,
    7. Lloret I,
    8. Micci F and
    9. Heim S
    : Presence of a t(12;18)(q14;q21) chromosome translocation and fusion of the genes for high-mobility group AT-Hook 2 (HMGA2) and WNT inhibitory factor 1 (WIF1) in infrapatellar fat pad cells from a patient with Hoffa’s disease. Cancer Genomics Proteomics 19(5): 584-590, 2022. PMID: 35985683. DOI: 10.21873/cgp.20343
    OpenUrlAbstract/FREE Full Text
  17. ↵
    1. Panagopoulos I,
    2. Andersen K,
    3. Gorunova L,
    4. Lund-Iversen M,
    5. Lobmaier I and
    6. Heim S
    : Recurrent fusion of the genes for high-mobility group AT-hook 2 (HMGA2) and nuclear receptor co-repressor 2 (NCOR2) in osteoclastic giant cell-rich tumors of bone. Cancer Genomics Proteomics 19(2): 163-177, 2022. PMID: 35181586. DOI: 10.21873/cgp.20312
    OpenUrlAbstract/FREE Full Text
  18. ↵
    1. Panagopoulos I,
    2. Gorunova L,
    3. Andersen K,
    4. Lobmaier I,
    5. Micci F and
    6. Heim S
    : Fusion of high mobility group AT-hook 2 gene (HMGA2) with the chromosome 12 open reading frame 42 gene (C12orf42) in an aggressive angiomyxoma with del(12)(q14q23) as the sole cytogenetic anomaly. Cancer Genomics Proteomics 19(5): 576-583, 2022. PMID: 35985684. DOI: 10.21873/cgp.20342
    OpenUrlAbstract/FREE Full Text
  19. ↵
    1. Panagopoulos I,
    2. Gorunova L,
    3. Andersen K,
    4. Lund-Iversen M,
    5. Hognestad HR,
    6. Lobmaier I,
    7. Micci F and
    8. Heim S
    : Chromosomal translocation t(5;12)(p13;q14) leading to fusion of high-mobility group AT-hook 2 gene with intergenic sequences from chromosome sub-band 5p13.2 in benign myoid neoplasms of the breast: a second case. Cancer Genomics Proteomics 19(4): 445-455, 2022. PMID: 35732319. DOI: 10.21873/cgp.20331
    OpenUrlAbstract/FREE Full Text
  20. ↵
    1. Polito P,
    2. Dal Cin P,
    3. Debiec-Rychter M and
    4. Hagemeijer A
    : Human solid tumors: cytogenetic techniques. Methods Mol Biol 220: 135-150, 2003. PMID: 12744212. DOI: 10.1385/1-59259-363-1:135
    OpenUrlCrossRefPubMed
  21. ↵
    1. Lukeis R and
    2. Suter M
    : Cytogenetics of solid tumours. Methods Mol Biol 730: 173-187, 2011. PMID: 21431642. DOI: 10.1007/978-1-61779-074-4_13
    OpenUrlCrossRefPubMed
  22. ↵
    1. McGowan-Jordan J,
    2. Hastings RJ and
    3. Moore S
    : ISCN 2020: An International system for human cytogenomic nomenclature. Basel, Switzerland, Karger, pp. 164, 2020.
  23. ↵
    1. Kangaspeska S,
    2. Hultsch S,
    3. Edgren H,
    4. Nicorici D,
    5. Murumägi A and
    6. Kallioniemi O
    : Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms. PLoS One 7(10): e48745, 2012. PMID: 23119097. DOI: 10.1371/journal.pone.0048745
    OpenUrlCrossRefPubMed
  24. ↵
    1. Nicorici D,
    2. Şatalan H,
    3. Edgren H,
    4. Kangaspeska S,
    5. Murumägi A,
    6. Kallioniemi O,
    7. Virtanen S and
    8. Kikku O
    : FusionCatcher - a tool for finding somatic fusion genes in paired-end RNA-sequencing data. bioRxiv, 2014. DOI: 10.1101/011650
    OpenUrlAbstract/FREE Full Text
  25. ↵
    1. Altschul SF,
    2. Gish W,
    3. Miller W,
    4. Myers EW and
    5. Lipman DJ
    : Basic local alignment search tool. J Mol Biol 215(3): 403-410, 1990. PMID: 2231712. DOI: 10.1016/S0022-2836(05)80360-2
    OpenUrlCrossRefPubMed
  26. ↵
    1. Gerhard-Hartmann E,
    2. Vokuhl C,
    3. Roth S,
    4. Steinmüller T,
    5. Rosenfeldt M,
    6. Zamò A,
    7. Rosenwald A,
    8. Appenzeller S,
    9. Ernestus K and
    10. Maurus K
    : The histological and molecular spectrum of lipoblastoma: A case series with identification of three novel gene fusions by targeted RNA-sequencing. Pathol Res Pract 226: 153591, 2021. PMID: 34455363. DOI: 10.1016/j.prp.2021.153591
    OpenUrlCrossRefPubMed
  27. ↵
    1. Nag S,
    2. Larsson M,
    3. Robinson RC and
    4. Burtnick LD
    : Gelsolin: the tail of a molecular gymnast. Cytoskeleton (Hoboken) 70(7): 360-384, 2013. PMID: 23749648. DOI: 10.1002/cm.21117
    OpenUrlCrossRefPubMed
  28. ↵
    1. Feldt J,
    2. Schicht M,
    3. Garreis F,
    4. Welss J,
    5. Schneider UW and
    6. Paulsen F
    : Structure, regulation and related diseases of the actin-binding protein gelsolin. Expert Rev Mol Med 20: e7, 2019. PMID: 30698126. DOI: 10.1017/erm.2018.7
    OpenUrlCrossRefPubMed
  29. ↵
    1. Hsieh CH and
    2. Wang YC
    : Emerging roles of plasma gelsolin in tumorigenesis and modulating the tumor microenvironment. Kaohsiung J Med Sci 38(9): 819-825, 2022. PMID: 35942641. DOI: 10.1002/kjm2.12578
    OpenUrlCrossRefPubMed
  30. ↵
    1. Yin HL,
    2. Kwiatkowski DJ,
    3. Mole JE and
    4. Cole FS
    : Structure and biosynthesis of cytoplasmic and secreted variants of gelsolin. J Biol Chem 259(8): 5271-5276, 1984. PMID: 6325429.
    OpenUrlAbstract/FREE Full Text
    1. Kwiatkowski DJ,
    2. Stossel TP,
    3. Orkin SH,
    4. Mole JE,
    5. Colten HR and
    6. Yin HL
    : Plasma and cytoplasmic gelsolins are encoded by a single gene and contain a duplicated actin-binding domain. Nature 323(6087): 455-458, 1986. PMID: 3020431. DOI: 10.1038/323455a0
    OpenUrlCrossRefPubMed
  31. ↵
    1. Kwiatkowski DJ,
    2. Mehl R and
    3. Yin HL
    : Genomic organization and biosynthesis of secreted and cytoplasmic forms of gelsolin. J Cell Biol 106(2): 375-384, 1988. PMID: 2828382. DOI: 10.1083/jcb.106.2.375
    OpenUrlAbstract/FREE Full Text
  32. ↵
    1. Meyer K,
    2. Kwon YC,
    3. Ray RB and
    4. Ray R
    : N-terminal gelsolin fragment potentiates TRAIL mediated death in resistant hepatoma cells. Sci Rep 7(1): 12803, 2017. PMID: 28993697. DOI: 10.1038/s41598-017-13131-7
    OpenUrlCrossRefPubMed
  33. ↵
    1. Rogalla P,
    2. Kazmierczak B,
    3. Meyer-Bolte K,
    4. Tran KH and
    5. Bullerdiek J
    : The t(3;12)(q27;q14-q15) with underlying HMGIC-LPP fusion is not determining an adipocytic phenotype. Genes Chromosomes Cancer 22(2): 100-104, 1998. PMID: 9598796. DOI: 10.1002/(sici)1098-2264(199806)22:2<100::aid-gcc3>3.0.co;2-0
    OpenUrlCrossRefPubMed
    1. Rogalla P,
    2. Lemke I,
    3. Kazmierczak B and
    4. Bullerdiek J
    : An identical HMGIC-LPP fusion transcript is consistently expressed in pulmonary chondroid hamartomas with t(3;12)(q27-28;q14-15). Genes Chromosomes Cancer 29(4): 363-366, 2000. PMID: 11066083.
    OpenUrlCrossRefPubMed
  34. ↵
    1. Dahlén A,
    2. Mertens F,
    3. Rydholm A,
    4. Brosjö O,
    5. Wejde J,
    6. Mandahl N and
    7. Panagopoulos I
    : Fusion, disruption, and expression of HMGA2 in bone and soft tissue chondromas. Mod Pathol 16(11): 1132-1140, 2003. PMID: 14614053. DOI: 10.1097/01.MP.0000092954.42656.94
    OpenUrlCrossRefPubMed
  35. ↵
    1. Komuro A,
    2. Raja E,
    3. Iwata C,
    4. Soda M,
    5. Isogaya K,
    6. Yuki K,
    7. Ino Y,
    8. Morikawa M,
    9. Todo T,
    10. Aburatani H,
    11. Suzuki H,
    12. Ranjit M,
    13. Natsume A,
    14. Mukasa A,
    15. Saito N,
    16. Okada H,
    17. Mano H,
    18. Miyazono K and
    19. Koinuma D
    : Identification of a novel fusion gene HMGA2-EGFR in glioblastoma. Int J Cancer 142(8): 1627-1639, 2018. PMID: 29193056. DOI: 10.1002/ijc.31179
    OpenUrlCrossRefPubMed
  36. ↵
    1. Lee MY,
    2. da Silva B,
    3. Ramirez DC and
    4. Maki RG
    : Novel HMGA2-YAP1 fusion gene in aggressive angiomyxoma. BMJ Case Rep 12(5): e227475, 2019. PMID: 31142482. DOI: 10.1136/bcr-2018-227475
    OpenUrlCrossRefPubMed
  37. ↵
    1. Agaimy A,
    2. Michal M,
    3. Stoehr R,
    4. Ferrazzi F,
    5. Fabian P,
    6. Michal M,
    7. Franchi A,
    8. Haller F,
    9. Folpe AL and
    10. Kösemehmetoğlu K
    : Recurrent novel HMGA2-NCOR2 fusions characterize a subset of keratin-positive giant cell-rich soft tissue tumors. Mod Pathol 34(8): 1507-1520, 2021. PMID: 33742141. DOI: 10.1038/s41379-021-00789-8
    OpenUrlCrossRefPubMed
  38. ↵
    1. Dehner CA,
    2. Baker JC,
    3. Bell R,
    4. Dickson BC,
    5. Schmidt RE,
    6. Demicco EG and
    7. Chrisinger JSA
    : Xanthogranulomatous epithelial tumors and keratin-positive giant cell-rich soft tissue tumors: two aspects of a single entity with frequent HMGA2-NCOR2 fusions. Mod Pathol 35(11): 1656-1666, 2022. PMID: 35690644. DOI: 10.1038/s41379-022-01115-6
    OpenUrlCrossRefPubMed
  39. ↵
    1. Brahmi M,
    2. Alberti L,
    3. Tirode F,
    4. Karanian M,
    5. Eberst L,
    6. Pissaloux D,
    7. Cassier P and
    8. Blay JY
    : Complete response to CSF1R inhibitor in a translocation variant of teno-synovial giant cell tumor without genomic alteration of the CSF1 gene. Ann Oncol 29(6): 1488-1489, 2018. PMID: 29668829. DOI: 10.1093/annonc/mdy129
    OpenUrlCrossRefPubMed
  40. ↵
    1. Fedele M,
    2. Berlingieri MT,
    3. Scala S,
    4. Chiariotti L,
    5. Viglietto G,
    6. Rippel V,
    7. Bullerdiek J,
    8. Santoro M and
    9. Fusco A
    : Truncated and chimeric HMGI-C genes induce neoplastic transformation of NIH3T3 murine fibroblasts. Oncogene 17(4): 413-418, 1998. PMID: 9696033. DOI: 10.1038/sj.onc.1201952
    OpenUrlCrossRefPubMed
    1. Crombez KR,
    2. Vanoirbeek EM,
    3. Van de Ven WJ and
    4. Petit MM
    : Transactivation functions of the tumor-specific HMGA2/LPP fusion protein are augmented by wild-type HMGA2. Mol Cancer Res 3(2): 63-70, 2005. PMID: 15755872. DOI: 10.1158/1541-7786.MCR-04-0181
    OpenUrlAbstract/FREE Full Text
  41. ↵
    1. Kubo T,
    2. Matsui Y,
    3. Goto T,
    4. Yukata K and
    5. Yasui N
    : Overexpression of HMGA2-LPP fusion transcripts promotes expression of the alpha 2 type XI collagen gene. Biochem Biophys Res Commun 340(2): 476-481, 2006. PMID: 16375854. DOI: 10.1016/j.bbrc.2005.12.042
    OpenUrlCrossRefPubMed
  42. ↵
    1. Lee YS and
    2. Dutta A
    : The tumor suppressor microRNA let-7 represses the HMGA2 oncogene. Genes Dev 21(9): 1025-1030, 2007. PMID: 17437991. DOI: 10.1101/gad.1540407
    OpenUrlAbstract/FREE Full Text
    1. Mayr C,
    2. Hemann MT and
    3. Bartel DP
    : Disrupting the pairing between let-7 and Hmga2 enhances oncogenic transformation. Science 315(5818): 1576-1579, 2007. PMID: 17322030. DOI: 10.1126/science.1137999
    OpenUrlAbstract/FREE Full Text
  43. ↵
    1. Klemke M,
    2. Meyer A,
    3. Hashemi Nezhad M,
    4. Belge G,
    5. Bartnitzke S and
    6. Bullerdiek J
    : Loss of let-7 binding sites resulting from truncations of the 3′ untranslated region of HMGA2 mRNA in uterine leiomyomas. Cancer Genet Cytogenet 196(2): 119-123, 2010. PMID: 20082846. DOI: 10.1016/j.cancergencyto.2009.09.021
    OpenUrlCrossRefPubMed
PreviousNext
Back to top

In this issue

In Vivo: 37 (2)
In Vivo
Vol. 37, Issue 2
March-April 2023
  • Table of Contents
  • Table of Contents (PDF)
  • About the Cover
  • Index by author
  • Back Matter (PDF)
  • Ed Board (PDF)
  • Front Matter (PDF)
Print
Download PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for your interest in spreading the word on In Vivo.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
Fusion of the High-mobility Group AT-Hook 2 (HMGA2) and the Gelsolin (GSN) Genes in Lipomas With t(9;12)(q33;q14) Chromosomal Translocation
(Your Name) has sent you a message from In Vivo
(Your Name) thought you would like to see the In Vivo web site.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
3 + 0 =
Solve this simple math problem and enter the result. E.g. for 1+3, enter 4.
Citation Tools
Fusion of the High-mobility Group AT-Hook 2 (HMGA2) and the Gelsolin (GSN) Genes in Lipomas With t(9;12)(q33;q14) Chromosomal Translocation
IOANNIS PANAGOPOULOS, KRISTIN ANDERSEN, MARTA BRUNETTI, LUDMILA GORUNOVA, MARIUS LUND-IVERSEN, FRANCESCA MICCI, SVERRE HEIM
In Vivo Mar 2023, 37 (2) 524-530; DOI: 10.21873/invivo.13110

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Reprints and Permissions
Share
Fusion of the High-mobility Group AT-Hook 2 (HMGA2) and the Gelsolin (GSN) Genes in Lipomas With t(9;12)(q33;q14) Chromosomal Translocation
IOANNIS PANAGOPOULOS, KRISTIN ANDERSEN, MARTA BRUNETTI, LUDMILA GORUNOVA, MARIUS LUND-IVERSEN, FRANCESCA MICCI, SVERRE HEIM
In Vivo Mar 2023, 37 (2) 524-530; DOI: 10.21873/invivo.13110
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Materials and Methods
    • Results
    • Discussion
    • Acknowledgements
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • PDF

Related Articles

Cited By...

  • Fusion of Platelet Derived Growth Factor Receptor Alpha (PDGFRA) With Ubiquitin Specific Peptidase 8 (USP8) in a Calcified Chondroid Mesenchymal Neoplasm Harboring t(4;15)(q12;q21) as a Sole Aberration
  • Google Scholar

More in this TOC Section

  • Association of Transforming Growth Factor-β1 and α-Smooth Muscle Actin in Experimental Selective Obstructive Cholestasis
  • Time-course Investigation of Bone and Disc Degeneration in a Rat Model of Pyogenic Spondylodiscitis
  • Plasma Exosomal miR-106b-5p Is Associated With Osteoporosis by Targeting SMAD5, BMP2, and MAPK1 Genes
Show more Experimental Studies

Keywords

  • Lipoma
  • chromosomal translocation
  • t(9;12)(q33;q14)
  • high mobility group AT-hook 2 (HMGA2) gene
  • gelsolin gene (GSN)
  • HMGA2::GSN chimera
In Vivo

© 2026 In Vivo

Powered by HighWire