An Improved Encapsulation Method for Cryopreserving Hepatocytes for Functional Transplantation Using a Thermo-reversible Gelation Polymer

Materials and Methods

Animals. Sprague-Dawley (SD) rats (250-350 g, Saitama Experimental Animals Supply, Saitama, Japan) were housed under 12-hour light/dark cycles for over 7 days before surgery. Animal studies were performed at the Laboratory Animal Center of Showa University School of Medicine and approved by the Showa University Ethics Committee for Animal Care and Use. All aseptic operations were under general anesthesia.

Rat hepatocytes. Rat liver cells were harvested by a two-step EDTA/collagenase digestion in situ as previously described (11). Following enrichment through a Percoll density gradient, cell viability was determined to be greater than 95%, assessed using the trypan-blue dye-exclusion test.

Preparation of thermo-reversible gelation polymer (TGP). Under a clean-air laminar-flow hood, a flask containing 10 ml of sterile Mebiol gel (supplied by Mebiol Gel Inc., Ltd, Hiratsuka, Japan from Nichi In Drugs & Devices (Pvt) Ltd, Chennai, India) was opened and 10 ml Eagle's Minimum Essential Medium (MEM) containing gentamicin 50 mg/ml ciprofloxacin 10 mg/ml and 10% fetal bovine serum (FBS) (all obtained from HiMedia, Mumbai, India) were included. The gel was dissolved in the medium at 4 to 8°C within 72 h.

Hepatocyte isolation and microencapsulation. Figure 1 illustrates the microencapsulation technique. Hepatocytes (1×10⁷) suspended in a small amount of Dulbecco's MEM (DMEM) were mixed with 5 ml of TGP/MEM at 4°C. Droplets containing hepatocytes in TGP/MEM formed microcapsules by extrusion through a 21 G needle, followed by placing them in a beaker containing 10 ml paraffin oil (PO) (No. 7162, Merck, Darmstadt, Germany) and rotation at 4°C. This resulted in the solidification of the microcapsules, which became further water-insoluble after being heated above the soluble-gel transition temperature (SGTT) for 10 min. The beaker containing 10 ml DMEM was immersed in a 37°C water bath and shaken gently to precipitate the microcapsules. The microcapsules were then washed in DMEM, and those with diameters between 150 and 300 μm were spontaneously formed.

Cryopreservation of hepatocytes. Isolated encapsulated rat hepatocytes were placed in a cryopreservation medium consisting of 10% dimethyl sulfoxide (DMSO), 10% FBS and 80% Dulbecco's Modified Eagle Medium (DMEM). Aliquots of encapsulated hepatocytes were distributed in 1.8 ml freezing vials (Nunc, Denmark), which were immediately frozen in liquid nitrogen for storage.

In order to thaw the encapsulated hepatocytes, the vials were placed in a 37°C water bath until the liquid in the tube was melted. The encapsulated hepatocytes were pipetted out and were washed with DMEM containing 10% FBS. The aliquots were then transferred to DMEM culture medium in dishes.

Culture of cryopreserved hepatocytes. Cryopreserved hepatocytes (1×10⁷) were placed in DMEM enriched with 0.2% bovine serum albumin, 10% FBS, 10 mM nicotinamide, 25 mM NaHCO₃, 20 ng/ml EGF, 10^-7 M dexamethasone, 30 μg/ml L-proline, 0.5 mM glutamine, 1 mg/ml galactose, 20 mM HEPES, 0.1 mM L-ascorbic acid 2-phosphate (Acs-2P), 0.5 μg/ml insulin-transferrin-selenium-X 51500 (ITS 51500, Life Technologies, Rockville, MD, USA), 50 μg/ml streptomycin and, 100 μg/ml penicillin, and transferred to a suspension-culture dish (60 mm×15 mm, Corning Incorporated, Corning, NY, USA) and cultured for 28 days. Cell cultures were incubated at 37°C in a humidified atmosphere containing 5% CO₂, and the medium was changed every other day.

Cell viability assays. The trypan-blue exclusion test was used to examine the viability of hepatocytes before and at specific times after cryopreservation as previously described (12).

Measurement of albumin production in culture. Albumin production and urea synthesis were measured, in the 3 groups below, in order to evaluate hepatic function in freeze-thaw and post-thaw culture conditions. The groups were: Group A: Non-cryopreserved rat hepatocytes; Group B: Non-cryopreserved rat hepatocytes with TGP; Group C: Cryopreserved rat hepatocytes with TGP.

Albumin production was analyzed in the medium on days 1, 3, 5, 7, 10, and 14 of culture, by utilizing a rat albumin ELISA kit (Shibayagi Co. Ltd., Gunma, Japan). The albumin levels in each of the samples in the medium was also determined.

Measurement of urea nitrogen synthesis in culture. Ammonium chloride (2.0 mM) was added in the culture medium on days 1, 3, 5, 7, 10, and 14 after plating. Six hours following the addition of ammonium chloride, the urea nitrogen concentration was measured using a urea-nitrogen diagnostic kit (Bioparmigen, San Diego, CA, USA). The extinction coefficient was measured with a spectrophotometer for measuring urea synthesis (UV-1200, Shimadzu Co., Ltd, Kyoto, Japan).

Histological assessment. Transplanted microencapsulated hepatocytes were fixed in 10% formaldehyde. Immunocytochemical staining of intracellular albumin in encapsulated rat hepatocytes was performed on paraffin sections. Immunocytochemical staining of intracellular albumin was demonstrated in cultured hepatocytes fixed in 10% formaldehyde. Briefly, the slides were incubated with a peroxidase blocking reagent (DAKO, Milan, Italy) for 10 min, washed, and incubated with a primary rabbit polyclonal antibody against rat albumin (Omega Scientific, Inc. Tarzana, CA, USA) for 30 min at room temperature. Subsequently, a secondary antibody (Omega Scientific, Inc. Tarzana, CA, USA) and a visualization reagent (DAKO) were added to the slide, which was incubated at room temperature for 30 min. Diaminobenzidine (DAB) was used as the chromogen.

RT-PCR analysis of albumin mRNA. Total RNA was isolated from hepatocytes of five different SD rats by using the acid guanidinium thiocyanate (GTC)-phenol-chloroform extraction method. The liver tissue was homogenized in GTC solution (4.0 M GTC containing 25 mM sodium citrate, pH 7.0, 0.5% sarkosyl, and 0.1 M 2-mercaptoethanol in a ratio of 10 ml GTC solution per 100 mg liver tissue). The RNA was extracted twice into phenol and chloroform (1 volume phenol/0.2 volumes chloroform/1 volume GTC solution) and precipitated with isopropanol at room temperature. The precipitated pellet was then dissolved in 0.3 ml of GTC solution and precipitated with isopropanol at −20°C, washed with ice-cold 80% ethanol and dissolved in an appropriate volume of diethylpyrocarbonate-treated water. The RNA yield, purity, and integrity were analyzed by the 260 nm/280 nm absorbance ratio (>1.6), which was confirmed by electrophoresis on 1.0% agarose/formamide gels.

One μg sample of total RNA was used for RT-PCR. The nucleotide sequences of the RT-PCR primers and the length of the amplified products were as follows: rat albumin, (CTGATATCTGCACACTCCCA and TCAGTGGCGAAGCAGTTATC, 181 bp). RT-PCR was performed under the following conditions according to the manufacturer's instructions (Toyobo, Osaka, Japan): 1 cycle at 60°C for 30 min, 1 cycle at 94°C for 2 min, 40 cycles at 91°C for 30 s, annealing at 62°C for 30 s, 72°C for 30 s, which was followed by a final extension at 72°C for 10 min. Amplified PCR products obtained from five different rats were loaded onto a 2.0% agarose gel.

Hepatocyte transplantation (HT) study. Hepatocytes from male SD rats were used as transplant donor cells, and male Nagase analbuminemic (NA) rats were used as recipients. With the rats under general anesthesia (achieved with diethyl ether), a small left subcostal incision was made to expose the spleen in each NA rat. Approximately 2×10⁷ cryopreserved unencapsulated hepatocytes in TGP, suspended in 1.5 ml of phosphate-buffered saline, were injected into the spleen through an 18-gauge needle. Hemostasis at the injection site was achieved with 2-0 silk sutures. Each group was subcutaneously injected with 1 mg/kg FK506 (Astellas Pharmaceutical Co., Ltd, Tokyo, Japan) daily for one week before and two weeks after HT, then once a week until the end of the experiment. Rats were sacrificed at various times following HT, and the spleen was collected.

Measurements of albumin production in NA Rats. In order to evaluate the efficacy of HT, the levels of albumin were determined in serum. Samples were measured using a standard blood chemistry method, automatic analyzer.

Morphologic studies of transplanted hepatocytes in the spleens of NA rats. The spleens that underwent HT were processed for histology. Paraffin-embedded sections (4 μm) were stained with H&E, PAS, and immunocytochemistry for albumin.

Periodic acid–Schiff's (PAS) staining. Transplanted hepatocytes were fixed in 10% formaldehyde for 30 min, oxidized in 10 g/l periodic acid for 10 min and rinsed three times in distilled water (dH2O). The cells were then placed in Schiff's reagent for 10 min, rinsed in dH₂O for 10 min, and stained with H-E for 2 min. After mixing with 1% alcohol/HCL, the cells were rinsed in dH2O and examined using a light microscope.

Statistical analysis. All values are presented as mean±standard deviation (SD). The Student's t-test was performed. p<0.05 was considered significant.