Abstract
The aim of the present study was to investigate the methylation status in the promoter region of Dipeptidyl peptidase-IV (Dpp4) gene, in livers from obese Zucker rats with different patterns of immunohistochemical positivity. Molecular analysis was carried-out on DNA obtained from livers of obese and lean Zucker rats and of control Wistar rats using the bisulfite conversion method and DNA sequencing. Our study focused on the genomic region of 1,000 bp, which includes the final part of 680 bp of the Dpp4 gene promoter and a small stretch of 320 bp at the beginning of the gene. The results indicate that the different immunohistochemical pattern of DPP4 observed in obese (fa/fa) and lean (fa/-) Zucker rats is not correlated to DNA methylation of its promoter. This is in agreement with the results of other studies carried-out on visceral and subcutaneous adipose tissue with varying levels of enzyme expression, in which differences in the methylation pattern of the Dpp4 promoter region were not observed.
The Dipeptidyl peptidase-IV (DPP4 or CD26) (1) is a ubiquitously expressed 110-kDa type-II integral glycoprotein which exists in two forms: one linked to the membrane of different cell types and the other soluble in biological fluids. It is an enzyme that cleaves N-terminal dipeptides of proline or alanine-containing peptides, including incretins, appetite-suppressing hormones (neuropeptide) and chemokines. Representative targets are glucagon-like peptide (GLP1, GLP2), gastric inhibitory peptide (GIP), neuropeptides (peptide YY, vasoactive intestinal peptide, substance P), chemokine ligand 12/stromal-derived factor-1 and growth hormone-releasing hormone (2). Thus, DPP4 exerts pleiotropic effects on glucose metabolism, gut motility, appetite regulation, inflammation, immune system function and pain regulation through its peptidase activity.
DPP4 is expressed on the surface of most cell types and is involved in immune regulation, signal transduction and apoptosis. In the immune network, this protein is also known as T-cell activation protein (3, 4) and can bind CD45 antigen and adenosine deaminase to play a co-stimulatory function. Resting B-lymphocytes and natural killer cells express low levels of CD26 on their surface, but after antigenic stimulation, expression of this protein becomes up-regulated.
Recently, DPP4 has been proposed as a marker of visceral obesity, insulin resistance and metabolic syndrome (5). Although under these pathological conditions significant increase in serum levels of DPP4 has been observed, the picture remains complex and little is known on the activity of DPP4 in organs such as the liver and kidney in obese individuals.
DPP4 is expressed at high levels in all the structures of the biliary tract and is up-regulated by the levels of incretins GLP-1 and GIP, which are, in turn, stimulated by high levels of glucose (6-9). DPP4 inhibitors are indeed used to treat type II diabetes. Neuropeptides that regulate bile transport and composition are other important substrates of DPP4 in the enterohepatic axis. For this reason, DPP4 can be considered a useful marker for evaluating liver functionality. It was recently suggested that DPP4 might play a role in the progression of non-alcoholic fatty liver disease (10); in particular increased hepatic expression of DPP4 may be associated with metabolic factors including insulin resistance, and may adversely affect glucose metabolism in this type of liver disease (11). Furthermore, several DPP4 substrates are implicated in the pathogenesis of non-alcoholic steatohepatitis (12).
In previous work of our group, we studied DPP4 expression in the biliary tree, to elucidate correlation between modifications of the various structures following stress conditions and differences in its expression levels. Our study was conducted using an experimental model of obese homozygous Zucker rats (fa/fa) compared to non-obese heterozygous Zucker rats (fa/+) and normal Wistar rats. With immunohistochemical analysis, strong variations in the pattern of expression of DPP4 were observed among the homozygous fa/fa individuals (13), but not in the heterozygous (fa/+) Zucker rats or in the control Wistar rats. As a consequence, epigenetic factors were suspected to be responsible for the different patterns of DPP4 expression occurring in genetically homogeneous animals.
In the present study, we aimed to investigate the possibility of epigenetic regulation mediated by DNA methylation in the promoter region of Dpp4 gene because as far as we are aware of, this possibility has not yet been explored. Molecular analysis was carried-out on genomic DNA obtained from liver of obese and lean Zucker rats and from control Wistar rats.
Materials and Methods
Animals. Six Male Wistar rats (250-300 g) (Harlan-Nossan, Corezzana, MB, Italy), six obese (fa/fa) (375±15 g) and six lean (fa/+) (300±10 g) male Zucker rats (Charles River, Italy), 11-12 weeks old, were used as liver donors. The use and care of animals was approved by the Italian Ministry of Health and by the University Commission for Animal Care (Approval Number No. 2/2012). Animals were given free access to water and food. Rats were sacrified after anesthetization with sodium pentobarbital (40 mg/kg intraperitoneally). The liver was removed, washed in ice-cold PBS solution and samples were snap-frozen in liquid nitrogen.
DPP4 expression by brightfield immunotechnique. Blocks of tissue of about 5 mm length were cut, fixed in 2% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4), then placed in Paraplast Embedding Media X-tra (Sigma, Milan, Italy). Sections of 8 μm thickness were obtained from Paraplast blocks with a microtome Leica Microsystem RM2155 (Leica Biosystems, Nussloch, Germany) and picked up on polylysinated glass slides. The specimens were incubated overnight at 37°C, then hydrated in graded alcohol through to distilled water. To unmask the binding sites of the primary antibody, specimens were maintained at 95°C for 15 min in 0.83% Vector buffer (pH 7) in distilled water (Antigen Unmasking Solution H3300; Vector Laboratories Inc., Burlingame, CA, USA), then rinsed twice in distilled water for 5 min. To block endogenous peroxidases, slides were incubated for 20 min at room temperature in a moist chamber in the dark with phosphate-buffered saline (PBS) solution containing 10% methanol and 3% H2O2 and then were rinsed twice in PBS with 1% Triton-X 100. To block non-specific binding sites, specimens were pre-incubated for 1 h in a moist chamber with a PBS solution containing 3% normal goat serum, 3% bovine serum albumin (BSA) and 0.5 M NaCl, at room temperature and in the dark. Then overnight incubation with a mouse monoclonal primary antibody sc-52642 to DPP4 (clone 5E8, 1:50; Santa Cruz Biotechnology, CA, USA) in blocking solution was performed. At the end of incubation, slides were rinsed twice in PBS containing 1% Triton X-100 for 5 min and incubated for 1 h at room temperature with a PBS blocking solution containing 3% normal goat serum, 3% BSA and 0.5 M NaCl. The reaction was amplified by means of 30-min incubation with secondary antibody Dako EnVision + System HRP Labelled Polymer Anti-Mouse (Dako Italia-spa, Milan, Italy) at room temperature. Finally after rinsing in PBS with 1% Triton X-100, the specimens were incubated in a moist chamber with 3,3’-diaminobenzidine tetrahydrochloride Substrate Chromogen System solution (Dako, Italia-spa, Milan, Italy) according to the manufacturer's specifications in the dark, at room temperature. At the end of incubation, the slides were rinsed in PBS and in distilled water, dehydrated in graded alcohol and mounted with Entellan (Merck, Darmstadt, Germany). The positive reaction product was a brown color. Control reactions replacing the primary antibody with the block solution were set up in parallel.
DNA extraction. Total cellular DNA was isolated from cryo-conserved liver samples of Wistar rats, and of obese and lean Zucker rats. The extraction was performed using the DNeasy® Blood & Tissue Kit (QIAGEN, Venlo, Nederlands) according to the manufacturer's specifications. Nuclease-free reagents and consumables were used to avoid DNA degradation. The DNA concentration was determined by Qubit® fluorometer using the dsDNA HS (high sensitivity) assay (Invitrogen-Life Technologies, Carlsbad, CA, USA) and then stored at −20°C until analysis.
Bisulfite treatment and amplification of DNA. Aliquots of 500 ng of genomic DNA were treated with sodium bisulfite using the EpiTect Bisulfite Kit (Qiagen). Bisulfite-treated DNA was amplified by means polymerase chain reaction (PCR) using two different pairs of primers designed by means of EpiDesigner BETA software (SEQUENOM®, San Diego, CA, USA) and based on Rattus norvegicus Dpp4 sequence (Ensemble Genome Browser) and considering a region of 1000-bp, covering 680 bp of the promoter region and 320 bp of the Dpp4 gene from the 44359900 to 44360900 position.
PCR reactions to amplify the forward strand (f) were performed using the following primers: fEPISL(5’-3’ GTTTAAAGTAATTT TTTATTTAAGAAGTGG) plus fEPISR (5’-3’TTCCAAAACTC AATACCTAAATCCTA); PCR reactions to amplify the reverse strand (r) were performed using the following primers: rEPISL (5’-3’ TTTATTTGTTGGAGTGGTTTTATGG) plus rEPISR (5’-3’ ACTCCATACCCTCTTAAACCTCAAC). PCR reaction mixtures (50 μl) containing 3 μl of converted DNA template, 2 μl of each primer, 25 μl hot start GoTaq Green Master Mix (Promega-Italia S.r.l., Milan, Italy), and 18 μl of nuclease free water were performed with the MJ, BIO-RAD thermocycler under the following conditions: hot start at 94°C for 2 min, 30 cycles of 30 sec at 94°C, 1 min at 55,7°C and 1 min at 72°C, with a final extension of 5 min at 72°C.
Electrophoresis analysis and PCR product sequencing. 5 μl of each PCR products were analyzed following electrophoresis on agarose gel (2%) containing ethidium bromide (0.005 μg/ml) and using 100-bp DNA (Fermentas-Life Technologies, Carlsbad, CA, USA) as ladder. The remaining PCR products were purified with MinElute PCR purification columns (QIAGEN) and after subjected to the sequence analysis (Sanger method). Finally a bioinformatic analysis to compare the sequences obtained with those present in the European Molecular Biology Laboratory (EMBL) database were performed.
Results
DPP4 expression was determined by means of immunohistochemistry using mouse monoclonal primary antibody to anti-DPP4 as described in the Materials and Methods section. From the results, all samples from lean rats displayed the same pattern, on the contrary a varied phenotype with differences in intensity of DPP4 positivity was observed in obese rats. In particular, some individuals showed a pattern of expression similar to that of Wistar rats (control) and of lean Zucker rats, whereas others had different levels of enzyme expression, ranging from an almost complete absence of positivity to high positivity. In Figure 1, the different immunohistochemical patterns of DPP4 expression are compared, which can be considered as representative of the different subjects: a liver sample obtained from a Wistar rat, from a lean Zucker rat and from two different obese Zucker rats (obese 1, obese 2) are shown. Liver from both Wistar and lean Zucker rats display similar features to the typical ‘chicken-wire’ canalicular DPP4 pattern as described in literature (14). Otherwise in fatty livers from Zucker rats, a variability in the enzyme expression among the different individuals was observed: in the first case (obese 1), the parenchyma appears visibly damaged, with distorted canaliculi (Figure 1, arrows) because of numerous lipid droplets in hepatocytes around the centrolobular vein, with an irregular and discontinuous enzymatic expression; in the second case (obese 2), the canalicular network appears regular and similar to that of Zucker rat liver, notwithstanding the presence of microsteatosis in the midzone (obese 2, asterisks). Strong positivity in the other structures of the biliary tree, as for example in bile ducts (D), similar to that of lean liver, was also observed.
To verify if the variability observed in fatty livers might be due to epigenetic regulation consequent to different methylation in the Dpp4 promoter region, we analyzed the methylation of DNA obtained from liver of obese and lean Zucker rats and from Wistar control rats, focusing on the genomic region of 1,000 bp (44,359,900 to 44,360,900), which includes the final part of 680 bp of the Dpp4 promoter and a small stretch of 320 bp at the beginning of the gene (Figure 2). As a first step, amplification of DNA previously converted using the bisulfite method was carried out, with primers designed for the genomic trait considered. New primers able to amplify DNA derived from the conversion, were designed by EpiDesigner BETA (SEQUENOM®) and the Ensemble Genome Browser: after selecting a range of 1,000 bp between the Dpp4 promoter region and the gene itself (44359900 to 44360900) (Figure 2), two primer pairs were selected (see Materials and Methods) to amplify the DNA sequence of interest. The reaction products obtained were two different double-standed DNA: one corresponding to the forward strand and the other corresponding to the reverse strand of the original sequence. The reaction products were tested by electrophoresis analysis to verify the amplification of the genomic trait considered (Figure 3). Finally, the amplification products were submitted to sequence analysis and to a bioinformatic analysis. The four identified sequences were compared with the stretch of the reference sequence of Rattus norvegicus, corresponding to the portion of the promoter region of the DPP4-encoding gene. The results of this analysis showed that at the level of CpG dense regions of DPP4 gene promoter (CpG islands), most of the cytosines were unmethylated (Figure 4). The reference sequence aligned with the forward filament contains 11 cytosines. Comparing the methylation pattern of all individuals, only the cytosine in position three was found to be methylated. However, sequence analysis gave reliable results only for two samples (no. 23 and no. 24) and for the Wistar control rat (wt). As regards the other subjects, ambiguous results were obtained. The cytosine in position three was also methylated in two out of three individuals with fa/fa (fat phenotype) genotype and in the Wistar control rat.
The sequence of the reverse strand contained 16 cytosines, the fifth and the sixth of which were methylated (highlighted in green) in all individuals except number 30 (genotype fa/−, slender phenotype) and number 36 (genotype fa/fa, fat phenotype).
According to the results obtained, most of the cytosines in the promoter region of Dpp4 gene were unmethylated, both in fatty and len Zucker rats and in the Wistar control rat. Hence according to these results, the different expression phenotypes observed in obese (fa/fa) and lean (fa/−) Zucker rats is not affected by epigenetic regulation by DNA methylation.
Discussion
The aim of the present research was to search for differences in the methylation pattern of the promoter Dpp4 genomic region, close to the gene itself, in fatty liver of genetically homogeneous Zucker rats as a possible explanation of the variability in DPP4 histochemical positivity observed in our previous studies (15). Considering lean rats, the presence of methylated sequences in the promoter of the Dpp4 gene would be expected to result in reduced DPP4 positivity by immunohistochemistry (no. 23, no. 24); on the contrary, a low grade of methylation should have been found in the liver of rats that displayed high expression of DPP4 (no. 29, no. 30). The genomic stretch studied is next to the Dpp4 gene, which for this region, has the greatest likelihood of influencing the expression of the gene itself. Our study was not able to detect clear differences in the methylation pattern of the Dpp4 promoter region among the obese Zucker rats with different enzymatic positivity. The methylation of Dpp4 gene promoter has not yet been sufficiently studied, hence only few data about methylation in the Dpp4 promoter region are reported in the literature, despite the functionality of the Dpp4 gene being important for many diseases. In fact, DPP4 is a major physiological regulator that controls other regulatory peptides, neuropeptides, circulating hormones and chemokines. An increase in DPP4 level has been reported to be associated with diseases with autoimmune and non-autoimmune etiology, and to many metabolic diseases. A reduced DPP4 expression has been observed in some tumor types in melanoma cell lines (16), T-cell leukemia (17) and Sezary syndrome (18) and it has been suggested that DPP4 could act as a tumor suppressor (19). A study on melanoma cell lines found methylation of the Dpp4 gene promoter in the majority of tumoral lines (16).
Dipeptidyl peptidase-IV (DPP4) immunohistochemical patterns in control Wistar rats and lean and obese Zucker rats. DPP4 expression was similar in the Wistar and both lean and obese Zucker rats, with a regular morphology and characteristic canalicular ‘chicken-wire’ pattern, whereas in obese subject 1, expression is appreciably reduced, partially due to the altered parenchyma and canalicular disruption (arrows: bile canaliculi; D: bile ducts; asterisks: lipid droplets) scale bar=50 μm.
Genomic region of 1000 bp Dipeptidyl peptidase-IV (Dpp4) promoter. Inside the red line on chromosome 3, there is the 3q21 locus that contains Dpp4 gene. Inside the orange area, there is the genomic region (1000 bp) studied (44283079 to 44360220).
Electrophoretic analysis of Polymerase Chain Reaction products obtained using primers designed as described in the Materials and Methods section. In the figures the results obtained for 3 obese Zucker rats (ob), 3 lean Zucher rats (lean) and one control Wistar rat (W) are compared. In the upper part of the figure are shown the amplification products of the forward strand and in the lower part of the figure are shown the amplification products of the reverse strand. The 869 bp bands correspond to the amplification products of the forward strand. The 524 bp bands correspond to the amplification products of the reverse strand. A 100 bp DNA ladder was used as ruler.
Alignment of the sequences (both forward and reverse strands) amplified with the reference sequences of Rattus norvegicus in fatty liver from obese rats (fa/fa obese) that displayed a low immunohistochemical positivity for Dipeptidyl peptidase-IV (DPP4) enzyme. The sequences are compared with a control Wistar rat (wt) with homogeneous positivity in the parenchyma and rats (fa/- lean) with the typical ‘chicken-wire’ pattern of decreasing expression from the portal zone to the centrolobular zone. Unmethylated cytosines that, following treatment with bisulfate, were converted into uracil and then amplified as thymines, are highlighted in red. The methylated cytosines refractory to treatment with bisulfite that, as a consequence, were amplified as cytosines, are indicated with asterisks and highlighted in green. wt: WiId type.
In our model of steatosis, in which variability in DPP4 expression among individuals was observed, we were not able to correlate this variability to differences in the methylation status of Dpp4 gene promoter. These results are in agreement with another recent study on obese subjects (5), in which no differences in the methylation status of Dpp4 were detected, in both visceral and subcutaneous adipose tissues with varying levels of enzyme expression. It must be considered in addition, that DPP4 is expressed in adult hepatic stem and progenitor cells and it has been observed that its expression increases in cirrhotic liver, probably due to being involved in re-generation in chronically-inflammed liver (22). Hence, a higher or lesser expression of this enzyme in liver tissue may be a measure of the ability for tissue re-generation. This hypothesis is supported by the recent discovery of a new role of DPP4 as adipokine (5, 22) and is in agreement with our previous observation of an increased expression of DPP4 enzyme in obese liver from rats submitted to a sub-normothermic machine-perfusion preservation procedure, in respect to conventional cold storage (15). Consequently, an increase or a decrease of expression of this enzyme might be related to a greater or lesser residual re-generative capacity of damaged hepatic tissue. In this context, Dpp4 could be a predictive biomarker for residual re-generative capacity in patients with compromised livers, to be considered in evaluation of their eligibility for transplantation.
Acknowledgements
The Authors wish to thank dott. Valeria Curti for her skilful technical assistance.
Footnotes
Funding Statements
This work has been supported by Fondazione Cariplo, Grant No. 2011-0439 and by University of Pavia (FAR 2012-2013).
Conflicts of Interest
Authors declare no conflicts of interest.
- Received April 16, 2015.
- Revision received July 2, 2015.
- Accepted July 6, 2015.
- Copyright © 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved
References
In this issue
Jump to section
Related Articles
Cited By...
- No citing articles found.