Skip to main content

Main menu

  • Home
  • Current Issue
  • Archive
  • Info for
    • Authors
    • Editorial Policies
    • Advertisers
    • Editorial Board
    • Special Issues
  • Journal Metrics
  • Other Publications
    • Anticancer Research
    • Cancer Genomics & Proteomics
    • Cancer Diagnosis & Prognosis
  • More
    • IIAR
    • Conferences
  • About Us
    • General Policy
    • Contact
  • Other Publications
    • In Vivo
    • Anticancer Research
    • Cancer Genomics & Proteomics

User menu

  • Register
  • Subscribe
  • My alerts
  • Log in
  • My Cart

Search

  • Advanced search
In Vivo
  • Other Publications
    • In Vivo
    • Anticancer Research
    • Cancer Genomics & Proteomics
  • Register
  • Subscribe
  • My alerts
  • Log in
  • My Cart
In Vivo

Advanced Search

  • Home
  • Current Issue
  • Archive
  • Info for
    • Authors
    • Editorial Policies
    • Advertisers
    • Editorial Board
    • Special Issues
  • Journal Metrics
  • Other Publications
    • Anticancer Research
    • Cancer Genomics & Proteomics
    • Cancer Diagnosis & Prognosis
  • More
    • IIAR
    • Conferences
  • About Us
    • General Policy
    • Contact
  • Visit iiar on Facebook
  • Follow us on Linkedin
Research ArticleExperimental Studies

Influence of Circadian Time and Lighting Conditions on Expression of Melatonin Receptors 1 and 2 in Murine Lymphocytes

VITALIJ CERNYSIOV, RUTA BOZAITE, MYKOLAS MAURICAS and IRUTE GIRKONTAITE
In Vivo September 2014, 28 (5) 831-835;
VITALIJ CERNYSIOV
1State Research Institute Centre for Innovative Medicine, Department of immunology, Vilnius, Lithuania
2Department of Microbiology and Biotechnology, Faculty of Natural Sciences, Vilnius University, Vilnius, Lithuania
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
RUTA BOZAITE
1State Research Institute Centre for Innovative Medicine, Department of immunology, Vilnius, Lithuania
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
MYKOLAS MAURICAS
1State Research Institute Centre for Innovative Medicine, Department of immunology, Vilnius, Lithuania
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
IRUTE GIRKONTAITE
1State Research Institute Centre for Innovative Medicine, Department of immunology, Vilnius, Lithuania
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: igirkontaite{at}yahoo.com
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Abstract

Aim: To investigate the expression of membrane melatonin receptors in murine thymocytes, CD4+ T-cells, bone marrow cells and B-cells according to melatonin concentration in the blood. Materials and Methods: The levels of mRNA of melatonin receptors were investigated in the cells isolated during the day or during the night, corresponding to low and high melatonin concentrations in the blood. Results: Low levels of Mtnr1 and Mtnr2 transcripts were detected in thymocytes and splenic B-cells. The expression of membranous melatonin receptors in B-cells corresponds to melatonin concentration in the blood. Conclusion: The expression of Mtnr1 and Mtnr2 in murine lymphocytes is very weak. Melatonin may be involved in regulation of the expression of Mtnr1 and Mtnr2 in murine B-cells.

  • Melatonin
  • Mtnr1
  • Mtnr2
  • mouse
  • lymphocytes

The main role of melatonin is the regulation of circadian and seasonal biorhythms, however, it influences many other functions, including immune response. Melatonin is mainly produced by the pineal gland during the night in response to darkness and its production is inhibited by light (1). The secretion of melatonin reaches a maximum level at midnight and gradually decreases by the morning. Melatonin is also synthesized extrapineally in different tissues and cells,including the cells of the immune system (2).

Melatonin can bind three types of receptors: membranous receptors Mt1 and Mt2 (Mtnr1 and Mtnr2), cytosolic receptor Mt3 and nuclear receptors (3). The best characterized melatonin receptors, Mtnr1 and Mtnr2, belong to the G protein-coupled receptor superfamily (4). Mtnr1 and Mtnr2 are widely expressed by immune system cells. Mtnr1 and Mtnr2 were detected in the spleen and thymus (5-12). Mtnr1, additionally, was found in monocytes, B- and T-cells, thymocytes, and natural killer cells (6, 13). Melatonin acting via Mtnr1 increases interleukin-2 (IL2) production and proliferation in lymphocytes (2). Mtnr2 is involved in increased proliferation of murine splenocytes (11), and inhibition of rat leukocyte rolling (14).

Although Mtnr1 and Mtnr2 expression has been studied in other organisms, little is still known about their expression in organs and cells of the mouse immune system. Moreover, there are no data on the regulation of the expression of murine Mtrs. The amount of melatonin in the blood and the immunological response varies during the day and night (15, 16), but nothing is known about the influence of melatonin concentration on the expression of Mtnr1 and Mtnr2 in mice. Therefore, we investigated the expression of MTRs in murine lymphocytes (thymocytes, bone marrow cells, purified splenic B-cells, lymph node CD4+ T-cells) isolated from mice kept under different lighting conditions.

Materials and Methods

Experimental animals. BALB/c mice were bred and housed in our animal facility. The experiments with animals were performed according to international ethical standards. The research protocol was submitted to and approved by a Lithuanian State Food and Veterinary Service (permission number 0225). The rodents were given ad libitum access to food and water and maintained under a 12/12-h light/dark cycle. One group of mice (LD) was kept under normal light/dark conditions; another group (LL) was kept under constant artificial lighting (around 50 lux) for about one week before experiments. In some cases, daily melatonin (Sigma-Aldrich, St.Louis, MO, USA) injections (5 mg/kg) were given for one week before the experiment: the LL night+mel group were given melatonin injections at the time corresponding to the beginning of the dark time for LD mice; the LD day+mel mice were injected at the beginning of the light time. The animals were sacrificed by cervical dislocation 4 h after beginning the light (LD day) or dark (LD night) time. The mice kept under constant lighting (LL day) were sacrificed at the same time as LD day mice.

Cell preparation. Thymocytes, splenocytes, lymph node cells and bone marrow cells were isolated from 8- to 9-week-old BALB/c mice. Splenic B220+ B-cells and lymph node CD4+ T-cells were isolated using phycoerythrin (PE)-labeled antibodies to B220 or CD4 and anti-R-PE Magnetic Particles-DM (BD Biosciences, San Jose, CA, USA). Cell isolation was performed according the manufacturer's recommendations.

RNA isolation and cDNA synthesis. RNA was extracted using GeneJET™ RNA Purification Kit (Thermo Fisher Scientific Baltics, Vilnius, Lithuania) according the manufacturer's instructions. To remove DNA contamination, RNA was incubated for 30 minutes at 37°C with DNase (final concentration 0.1 U/ml). cDNA was synthesized using Maxima Reverse Transcriptase and random hexamer primers (Thermo Fisher Scientific Baltics, Vilnius, Lithuania).

The polymerase chain reaction (PCR). PCR was performed in a Rotor-Gene RG 6000-time real-time PCR instrument. Three pairs of primers for Mtnr1 were used. Primers Mtnr1 (A) were GGGCCCCACTCAACCTCATAG and AGCAGTAAGACCCCAACCAGTGTG; primers Mtnr1 (B) were ATCGCCATCATGCCCAACCT and TAACTAGCCACGAACAGCCACTCT; primers Mtnr1 (C) were CCGCAACAAGAAGCTCAGGAACTC and TCGTACTTGAGGCTGTGGCAAATG. The primers for Mtnr2 were AACCGCTACTGCTGCATCTGTCAT and AAACTGCGCAAATCACTCGGTCTC, the primers for house keeping gene Hypoxanthine-guanine phosphoribosyltransferase (Hprt) were GCTGGTGAAAAGGACCTCT and CACAGGACTAGAACACCTGC. All primers [except Mtnr1(C) 1 were designed using Lasergene.v.7.1 software, DNASTAR, Madison, WI, USA. The sequences of Mtnr1(C) were as described by Carrillo-Vico et al. (7). The cDNA was amplified in a reaction containing 2 μl of cDNA, 2 μl of 10×PCR buffer, 2 μl of 2 mM dNTP/dUTP mix, 2 μl of 25 mM MgCl, 4 μl of betain, 1 μl of 10 pM of each 5’- and 3’-primer, 26.6 μM of a fluorescence dye SYTO9 (Invitrogen, Carlsbad, CA, USA), 4.5 μl of nuclease-free water, 0.4 units of Uracil-DNA glycosidase and 0.5-0.75 units of Hot start Taq polymerase (Thermo Fisher Scientific). The PCR reaction was started by initial 2-min PCR step at 50°C and 5 min at 95°C followed by 40-45 cycles of target cDNA amplification (45 s at 95°C, 45 s depending on the primers from 54°C to 61°C and 45 s at 72°C). The last elongation was 2 min for 72°C. To exclude the contamination of genomic DNA, control PCRs were performed using isolated RNA (without cDNA synthesis). PCR products were separated by electrophoresis in 2% agarose gels, and visualized using an UV illuminator in the presence of ethidium bromide.

Detection of melatonin in mouse serum. The blood samples for melatonin detection were obtained from mice 4 h after beginning of the light or 4 h after beginning of the dark time. Melatonin in serum was detected using enzyme-linked immunosorbent assay kit (Cloud-clone Corp. Houston, TX, USA)

Results

Melatonin concentration in the serum of BALB/c mice. The melatonin concentration in the serum of LD and LL mice was determined. Blood was obtained at midday (4 h after beginning of the light time) and at midnight (4 h after beginning of the dark time). The melatonin concentration was increased in the sera of LD-night mice compare to LD-day and LL-day mice (Figure 1). The LL night mice had higher melatonin level than LL-day mice, but lower than LD-night mice.

Figure 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 1.

The level of melatonin in the serum of BALB/c mice. The melatonin was measured in the serum of mice kept under normal light/dark (LD) or constant light (LL) conditions. Blood was obtained 4 h after beginning of the light (day) and 4 h after beginning of the dark (night) time. The average of melatonin concentration determined in two mice is shown.

Expression of Mtnr1 and Mtnr2 in lymphocytes. The transcripts of Mtnr1 and Mtnr2 were analyzed using three different primer pairs for Mtnr1 and one primer pair for Mtnr2. PCR was performed from several samples of mRNA, prepared from different mice (Table I). The PCR from every sample was carried out in duplicates or triplicates. The levels of mRNA of Mtnr1 and Mtnr2 were very low. PCR products had relatively high Ct values (Ct=33-40). We did not find transcripts of Mtnr1 and Mtnr2 in the cDNA from CD4+ T-cells and bone marrow cells (data not shown). mRNA of Mtnr1 and Mtnr2 was detected in thymocytes isolated from most LD day, LL night and LL night+mel mice. PCR was not positive in all replicates of the same sample, indicating that the concentration of transcripts is very low and ranges around the detection limit (at least one copy of cDNA present in one aliquot of template and absent in the second aliquot); such samples are marked +/− in Table I. PCR product was not obtained with all primer pairs.

Transcripts of Mtnr1 and Mtnr2 in B-cells were not detected in the samples from LD-day and LL-night mice, but were found in the samples prepared from LD-night mice. Melatonin injection into the LL mice (LL night+mel mice) induced the expression of Mtnr1 and Mtnr2.

In conclusion, the expression of Mtnr1 and Mtnr2 in lymphocytes is very weak or undetectable. The presence of Mtnr1 and Mtnr2 transcripts in splenic B-cells depends on lighting conditions.

View this table:
  • View inline
  • View popup
  • Download powerpoint
Table I.

Expression of melatonin receptors Mtnr1 and Mtnr2 in thymocytes and B-cells isolated from spleen of mice kept under constant light (LL) and 12/12 light/dark (LD) conditions. Samples were taken 4 h after the beginning of the light (day) or 4 h after the beginning of the dark (night) time. The expression of melatonin receptors was analyzed by rtPCR.

Discussion

Herein, we investigated the expression of Mtrs in thymocytes, bone marrow cells, CD4+ T-cells, B-cells of BALB/c mice. Our results demonstrated that the levels of Mtnr1 and Mtnr2 transcripts in the tested cells were very low. We found expression of these receptors in the thymocytes and splenic B-cells, while such transcripts were not detected in CD4+ T-cells and bone marrow cells. The distribution of Mtnr1 and Mtnr2 mRNA was similar (they were found together in the same cells). It is interesting that melatonin surface receptors can form Mtnr1–Mtnr2 heterodimers (17), which also shows that both receptors are expressed together. Mtnr1 and Mtnr2 are expressed in thymus and spleen of rats (6, 12), tropical rodent Funambulus pennant (8, 9), the avian Perdicula asiatica (5), and the chicken (10). In addition, the expression of Mtnr1 and Mtnr2 in thymus and spleen of Swiss mouse was investigated by Carrillo-Vico et al. (7). The authors found both Mtnr1 and Mtnr2 transcripts in the thymus, however, only Mtnr1 transcripts were detected in the spleen. These receptors were analyzed by PCR followed by Southern blot but PCR product was not detectable on the agarose gel, which demonstrates the low expression of the investigated receptors. Mtnr2 was absent in the murine spleen (7). A weak signal of Mtnr1 mRNA was also obtained in human PBMC, monocytes, T- and B-cells, and natural killer cells (13). Taken together, these data show that the expression of Mtnr1 and Mtnr2 in lymphocytes is very low.

The amount of melatonin drops during aging, but the levels of Mtrs in thymus were significantly higher in 12-month-old rats than in 12-week-old ones (12). Comparing Mtnr1 expression in rats of the same age, Jimenez-Jorge et al. detected more Mtnr1 transcripts in the thymus at day time than at night time (18). Such results argue that the levels of surface Mtrs depend on the concentration of melatonin in the blood. These results show that melatonin negatively regulates the transcription of its own receptors in thymus. Hence we expected to obtain similar results in mice. However, we did not find a link between Mtnr1/Mtnr2 expression and melatonin concentration in the blood or circadian time. One possible explanation is that the amounts of Mtnr1 and Mtnr2 transcripts in the murine thymus were very low and varied between individual animals.

We detected mRNA of Mtnr1 and Mtnr2 in splenic B-cells only in the night (LD-night mice), which corresponds to the increased melatonin concentration in the blood. Age-dependent decrease of melatonin concentration in the serum and decrease in Mtnr1 and Mtnr2 expression in spleen was observed in rats (12) and F. pennanti (9). The circulating melatonin concentration and Mtr expression in thymus and spleen of F. pennanti were decreased during the long days of summer and increased during the short days of winter (8). Therefore, the expression of Mtrs depends on the concentration of the melatonin in the blood, which depens on the circadian time, length of day and animal age.

Ahmad et al. showed that melatonin directly regulates the expression of its membranous receptors. Physiological doses of melatonin up-regulated Mtnr1 and Mtnr2 expression in F. pennanti, while higher doses down-regulated the expression of both receptors in splenic cells (in vivo and in vitro) (19). Our experiments showed also that melatonin up-regulated the expression of its receptors. We did not find mRNA of Mtnr1 and Mtnr2 in B-cells when the melatonin concentration in the blood was supposedly low (LD day and LL night mice). Daily melatonin injections administered to mice kept at constant light (LL night+mel mice) restored the expression of Mtnr1 and Mtnr2. Differently from rodents, membrane Mtrs are down-regulated in the spleen of P. asiatica (5) but up-regulated in the lungs by melatonin during the night (20). Melatonin regulates the expression of Mtnr1 and Mtnr2 not only dependent on the concentration of the melatonin and circadian time, but also on the biological species and origin of the cells.

The increased Mtnr2 expression in B-cells during the night could be important for priming of immune response. We previously showed that melatonin modulates antibody secretion in mice via Mtnr2. The titter of specific antibody in the blood was higher when immunizations (B-cell priming) were carried out in the night compared to those in the morning (15), corresponding to higher melatonin concentration in the blood and increased Mtnr2 in B-cells. These data suggest that melatonin positively-regulates B-cell priming and antibody production.

In conclusion, melatonin may be involved in the regulation of the expression of Mtnr1 and Mtnr2 in murine B-cells.

Acknowledgements

We are grateful to Dr. Vilma Ubonaviciute for the help during preparation of the manuscript. We would like to thank to the staff of animal facility at the Department of Biomodels, State Research Institute Centre for Innovative Medicine. This work was supported by the Research Council of Lithuania (MIP-42/2010).

  • Received May 9, 2014.
  • Revision received June 26, 2014.
  • Accepted June 29, 2014.
  • Copyright © 2014 The Author(s). Published by the International Institute of Anticancer Research.

References

  1. ↵
    1. Wurtman RJ,
    2. Axelrod J,
    3. Phillips LS
    : Melatonin synthesis in the pineal gland: control by light. Science 142: 1071-1073, 1963.
    OpenUrlAbstract/FREE Full Text
  2. ↵
    1. Carrillo-Vico A,
    2. Lardone PJ,
    3. Fernandez-Santos JM,
    4. Martin-Lacave I,
    5. Calvo JR,
    6. Karasek M,
    7. Guerrero JM
    : Human lymphocyte-synthesized melatonin is involved in the regulation of the interleukin-2/interleukin-2 receptor system. J Clin Endocrinol Metab 90: 992-1000, 2005.
    OpenUrlCrossRefPubMed
  3. ↵
    1. Hardeland R,
    2. Cardinali DP,
    3. Srinivasan V,
    4. Spence DW,
    5. Brown GM,
    6. Pandi-Perumal SR
    : Melatonin–a pleiotropic, orchestrating regulator molecule. Prog Neurobiol 93: 350-384, 2011.
    OpenUrlCrossRefPubMed
  4. ↵
    1. Dubocovich ML,
    2. Delagrange P,
    3. Krause DN,
    4. Sugden D,
    5. Cardinali DP,
    6. Olcese J
    : International Union of Basic and Clinical Pharmacology. LXXV. Nomenclature, classification, and pharmacology of G protein-coupled melatonin receptors. Pharmacol Rev 62: 343-380, 2010.
    OpenUrlAbstract/FREE Full Text
  5. ↵
    1. Yadav SK,
    2. Haldar C,
    3. Singh SS
    : Variation in melatonin receptors (Mel(1a) and Mel(1b)) and androgen receptor (AR) expression in the spleen of a seasonally breeding bird, Perdicula asiatica. J Reprod Immunol 92: 54-61, 2011.
    OpenUrlPubMed
  6. ↵
    1. Pozo D,
    2. Delgado M,
    3. Fernandez-Santos JM,
    4. Calvo JR,
    5. Gomariz RP,
    6. Martin-Lacave I,
    7. Ortiz GG,
    8. Guerrero JM
    : Expression of the Mel1a-melatonin receptor mRNA in T- and B_subsets of lymphocytes from rat thymus and spleen. FASEB J 11: 466-473, 1997.
    OpenUrlAbstract
  7. ↵
    1. Carrillo-Vico A,
    2. Garcia-Perganeda A,
    3. Naji L,
    4. Calvo JR,
    5. Romero MP,
    6. Guerrero JM
    : Expression of membrane and nuclear melatonin receptor mRNA and protein in the mouse immune system. Cell Mol Life Sci 60: 2272-2278, 2003.
    OpenUrlCrossRefPubMed
  8. ↵
    1. Ahmad R,
    2. Haldar C
    : Photoperiodic regulation of Mt1 and Mt2 melatonin receptor expression in spleen and thymus of a tropical rodent Funambulus pennanti during reproductively active and inactive phases. Chronobiol Int 27: 446-462, 2010.
    OpenUrlPubMed
  9. ↵
    1. Ahmad R,
    2. Gupta S,
    3. Haldar C
    : Age-dependent expression of melatonin membrane receptor (Mtnr1, Mtnr2) and its role in regulation of nitrosative stress in tropical rodent Funambulus pennanti. Free Rad Res 46: 194-203, 2012.
    OpenUrlPubMed
  10. ↵
    1. Wronka M,
    2. Maleszewska M,
    3. Stepinska U,
    4. Markowska M
    : Diurnal differences in melatonin effect on intracellular Ca2+ concentration in chicken spleen leukocytes in vitro. J Pineal Res 44: 134-140, 2008.
    OpenUrlPubMed
  11. ↵
    1. Drazen DL,
    2. Nelson RJ
    : Melatonin receptor subtype Mt2 (Mel 1b) and not Mt1 (Mel 1a) is associated with melatonin-induced enhancement of cell-mediated and humoral immunity. Neuroendocrinology 74: 178-184, 2001.
    OpenUrlCrossRefPubMed
  12. ↵
    1. Sanchez-Hidalgo M,
    2. Guerrero Montavez JM,
    3. Carrascosa-Salmoral Mdel P,
    4. Naranjo Gutierrez Mdel C,
    5. Lardone PJ,
    6. de la Lastra Romero CA
    : Decreased MT1 and MT2 melatonin receptor expression in extrapineal tissues of the rat during physiological aging. J Pineal Res 46: 29-35, 2009.
    OpenUrlCrossRefPubMed
  13. ↵
    1. Pozo D,
    2. Garcia-Maurino S,
    3. Guerrero JM,
    4. Calvo JR
    : mRNA expression of nuclear receptor RZR/RORalpha, melatonin membrane receptor MT, and hydroxyindole-O-methyltransferase in different populations of human immune cells. J Pineal Res 37: 48-54, 2004.
    OpenUrlCrossRefPubMed
  14. ↵
    1. Lotufo CM,
    2. Lopes C,
    3. Dubocovich ML,
    4. Farsky SH,
    5. Markus RP
    : Melatonin and N-acetylserotonin inhibit leukocyte rolling and adhesion to rat microcirculation. Eur J Pharmacol 430: 351-357, 2001.
    OpenUrlCrossRefPubMed
  15. ↵
    1. Cernysiov V,
    2. Gerasimcik N,
    3. Mauricas M,
    4. Girkontaite I
    : Regulation of T-cell-independent and T-cell-dependent antibody production by circadian rhythm and melatonin. Int Immunol 1: 25-34, 2009.
    OpenUrl
  16. ↵
    1. Cernysiov V,
    2. Mauricas M,
    3. Girkontaite I
    : Leucocyte infiltration in lymphoid organs and peritoneal cavity upon immunization: dependence on circadian rhytmicity and melatonin 24-h profile. EurJ Inflamm 9: 219-229, 2011.
    OpenUrl
  17. ↵
    1. Levoye A,
    2. Jockers R,
    3. Ayoub MA,
    4. Delagrange P,
    5. Savaskan E,
    6. Guillaume JL
    : Are G protein-coupled receptor heterodimers of physiological relevance? –Focus on melatonin receptors. Chronobiol Int 23: 419-426, 2006.
    OpenUrlCrossRefPubMed
  18. ↵
    1. Jimenez-Jorge S,
    2. Jimenez-Caliani AJ,
    3. Guerrero JM,
    4. Naranjo MC,
    5. Lardone PJ,
    6. Carrillo-Vico A,
    7. Osuna C,
    8. Molinero P
    : Melatonin synthesis and melatonin-membrane receptor (Mt1) expression during rat thymus development: role of the pineal gland. J Pineal Res 39: 77-83, 2005.
    OpenUrlCrossRefPubMed
  19. ↵
    1. Ahmad R,
    2. Haldar C,
    3. Gupta S
    : Melatonin membrane receptor type Mt1 modulates cell-mediated immunity in the seasonally breeding tropical rodent Funambulus pennanti. Neuroimmunomodulation 19: 50-59, 2012.
    OpenUrlPubMed
  20. ↵
    1. Kharwar RK,
    2. Haldar C
    : Reproductive phase dependent daily variation in melatonin receptors (Mel(1a) and Mel(1b)), androgen receptor (Ar) and lung associated immunity of Perdicula asiatica. Comp Biochem Physiol A Mol Integr Physiol 159: 119-124, 2011.
    OpenUrlPubMed
PreviousNext
Back to top

In this issue

In Vivo
Vol. 28, Issue 5
September-October 2014
  • Table of Contents
  • Table of Contents (PDF)
  • Index by author
  • Back Matter (PDF)
  • Ed Board (PDF)
  • Front Matter (PDF)
Print
Download PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for your interest in spreading the word on In Vivo.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
Influence of Circadian Time and Lighting Conditions on Expression of Melatonin Receptors 1 and 2 in Murine Lymphocytes
(Your Name) has sent you a message from In Vivo
(Your Name) thought you would like to see the In Vivo web site.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
10 + 8 =
Solve this simple math problem and enter the result. E.g. for 1+3, enter 4.
Citation Tools
Influence of Circadian Time and Lighting Conditions on Expression of Melatonin Receptors 1 and 2 in Murine Lymphocytes
VITALIJ CERNYSIOV, RUTA BOZAITE, MYKOLAS MAURICAS, IRUTE GIRKONTAITE
In Vivo Sep 2014, 28 (5) 831-835;

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Reprints and Permissions
Share
Influence of Circadian Time and Lighting Conditions on Expression of Melatonin Receptors 1 and 2 in Murine Lymphocytes
VITALIJ CERNYSIOV, RUTA BOZAITE, MYKOLAS MAURICAS, IRUTE GIRKONTAITE
In Vivo Sep 2014, 28 (5) 831-835;
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Materials and Methods
    • Results
    • Discussion
    • Acknowledgements
    • References
  • Figures & Data
  • Info & Metrics
  • PDF

Related Articles

Cited By...

  • No citing articles found.
  • Google Scholar

More in this TOC Section

  • Association of Transforming Growth Factor-β1 and α-Smooth Muscle Actin in Experimental Selective Obstructive Cholestasis
  • Time-course Investigation of Bone and Disc Degeneration in a Rat Model of Pyogenic Spondylodiscitis
  • Plasma Exosomal miR-106b-5p Is Associated With Osteoporosis by Targeting SMAD5, BMP2, and MAPK1 Genes
Show more Experimental Studies

Keywords

  • Melatonin
  • Mtnr1
  • Mtnr2
  • mouse
  • Lymphocytes
In Vivo

© 2026 In Vivo

Powered by HighWire