Ethanol Inhibits B16-BL6 Melanoma Metastasis and Cell Phenotypes Associated with Metastasis

Materials and Methods

Cancer cells and cell culture reagents. B16-BL6 melanoma cells (kindly provided by Dr. Isiah J. Fidler, University of Texas at MD Anderson, Houston, TX, USA) were cultured in Dulbecco's modified minimum essential medium (DMEM; Invitrogen, Carlsbad, CA, USA), pH 7.4, containing 10% heat-inactivated fetal bovine serum (FBS; Invitrogen) and 1% antibiotic-antimycotic solution (CellGro, Manassas, VA, USA). The cells were grown at 37°C in a humidified atmosphere of 5% CO₂. For cell culture studies, B16-BL6 cells were exposed to 0.1%, 0.2% or 0.5% v/v ethanol (Sigma Aldrich, St. Louis, MO, USA) as indicated.

Animal studies. All animal procedures and methods employed in our studies were approved by the Animal Care and Use Committee at the University of Texas at Austin. Pathogen free male ob/+ heterozygous C57BL/6J mice were purchased from The Jackson Laboratory (JAX, Bar Harbor, MN, USA) at 6-8 weeks old and housed according to NIH guidelines (25). They were singly housed and acclimated for a week before being randomized into either water or ethanol-drinking groups (n=12). Ethanol-consuming mice were acclimated to 20% v/v ethanol as follows: they received 5% v/v ethanol in the water for the first 2 weeks, 10% v/v ethanol for the next 2 weeks, 15% v/v ethanol for next 2 weeks, and 20% v/v ethanol for the rest of the study. Previously, we showed that mice consuming 20% ethanol in their drinking water had an average blood alcohol level of ~40-50 mg/dl, which are the physiological blood alcohol levels found in people who regularly consume alcohol (11). Additionally, these alcohol levels are lower than 80 mg/dl, which is considered the level for an individual to be legally intoxicated in most states in the US (26). Both water- and ethanol-consuming mice were fed a low-fat (5% fat) chow diet (Research Diets, New Brunswick, NJ, USA). We measured body weight, food, and liquid consumption on a weekly basis. After 10 weeks on either water or 20% v/v ethanol, about 150 μl of blood was collected from each mouse via retro-orbital bleeding to determine blood alcohol levels.

B16-BL6 pulmonary metastasis. After mice had consumed water or 20% ethanol for over 10 weeks, they were anesthetized using isoflurane, then injected via the retro-orbital vein with 100ul DMEM containing 1×10⁵ B16-BL6 melanoma cells; mice continued to consume water or 20% ethanol throughout the study. After cancer cell injection, mice were euthanized at 10, 16, 19, or 21 days to determine pulmonary metastases (n=3). For this purpose, the lungs were inflated and fixed in 10% formalin for 24 h, at which point they were stored in 70% ethanol. Pulmonary metastases for each mouse were determined by counting the total number of metastatic foci in each lung.

Cytokine analysis and blood chemistry. Serum collected from each mouse was used to determine the effect of ethanol on systemic levels of leptin, insulin, interleukin 6 (IL-6), tumor necrosis factor-alpha (TNF-α), resistin, tissue plasminogen activator inhibitor-1 (tPAI-1), and monocyte chemotactic protein-1 (MCP-1). For this purpose, Multiplex MAP Mouse Serum Adipokine Panel (Millipore, Billerica, MA, USA) was used. Blood alcohol levels were measured using a NAD-ADH kit (Sigma-Aldrich) (n=12).

Invasion assay. We used a Boyden chamber assay to determine the effect of ethanol on the ability of B16-BL6 melanoma cells to invade (27). Briefly, the top chamber membrane was coated with a 1:10 dilution of BD Matrigel™ (BD Biosciences, Franklin Lakes, NJ, USA), then 5×10⁴ B16-BL6 melanoma cells were placed in the top chamber in serum-free DMEM with 0.1% bovine serum albumin (BSA) containing either no ethanol (0%), 0.1% ethanol, 0.2% ethanol, or 0.5% ethanol. The lower chamber was filled with DMEM containing 5% FBS and the dose of ethanol. Cells were allowed to migrate from the top towards the bottom of each chamber. After 24 h, cells that remained on the top were removed using a Q-tip. Cells that had invaded to the bottom were fixed and stained using Diff-Quick Stain Set (Siemens, Malvern, PA, USA). Stained cells were visualized and quantified by microscopy. To determine the average number of cells that migrated for each well, the number of cells in 3 random fields in each well were counted at ×200. Each treatment had 6 wells per experiment, with each experiment being carried out three times (n=3). The above experiment was repeated using 0.5% ethanol and 5% mouse serum as the chemoattractant instead of 5% FBS.

Methylthiazol tetrazolium (MTT) proliferation assay. The MTT assay was used to determine the effect of ethanol on B16-BL6 cell viability and growth. Cells were plated in a 96-well plate and allowed to attach overnight. Cells were subsequently FBS-starved overnight before being treated with either control DMEM or 0.5% ethanol for 24 h. Cell viability and proliferation were measured according to the manufacturer's instructions (no. 30-1010K; ATCC, Chicago, IL, USA). Briefly, 10 μl of MTT reagent was added to the wells containing the cells given the different treatments. The plate was subsequently incubated for 4 h until purple precipitates were observed. Then 100 μl of Detergent Reagent was added to each well. Next, the plate was left at room temperature in the dark for 2 h and finally, the absorbance at 570 nm was measured for each well. Each experiment was repeated three times with each group having 4 wells per experiment (n=3).

Apoptosis assay. The apoptosis assay was used to determine if ethanol affected B16-BL6 cell death. B16-BL6 cells were grown to 70% confluency in 6 cm³ plates. Cells were rinsed with Phosphate buffered saline (PBS) and FBS-starved overnight. The cells were then treated with control DMEM or 0.5% v/v ethanol in DMEM for 24 h. Afterwards, cells were rinsed with PBS, trypsinized, and centrifuged at 10,000 rpm for 5 min at 4°C. The supernatant was decanted and the cell pellet was subsequently vortexed thoroughly to make a single-cell suspension. The percentage of apoptotic cells was determined by an assay-kit according to the manufacturer's instructions (no. 10010-02; Southern Biotech, Birmingham, AL, USA). Briefly, 1×10⁷ cells were resuspended in 1 ml 1× binding buffer, then 100 μl of this cell suspension was incubated with 10 μl of Annexin V-FITC for 15 min on ice. Next, 380 μl of 1× binding buffer was added to the suspension and lastly, 10 μl of propidium iodide (PI) was added and the percentage of apoptotic cells determined using flow cytometry. Appropriate negative controls (unstained cells) and single stained controls (Annexin V-FITC or PI alone) were used to determine the pro-apoptotic quadrants. Unstained cells in the lower left quadrant are the population of viable cells. Cells in the lower right quadrant that stained for Annexin V are in the early stages of apoptosis while the cells in the upper right quadrant that stained for Annexin V and PI are in the late stages of cell death. Cells in the upper left quadrant that stained positive for PI but negative for Annexin V consist of necrotic or dead cells. For our study, apoptotic cells were defined as the sum of the percentage of Annexin V-positive cells in both the lower and upper right quadrants. Three separate experiments were performed (n=3).

Wounding assay. The wounding assay was used to determine the effect of ethanol on the ability of B16-BL6 melanoma cells to migrate. In the wounding assay, cells were plated to 100% confluency and a scratch was drawn in the middle of the plate. The decrease in gap distance was measured over time and quantified; the larger the gap distance that remains, the less the cells have migrated. Briefly, B16-BL6 cells were grown on a 24-well plate until they were confluent. Then the cells were grown in FBS-free DMEM overnight. The next day, wells were washed twice with PBS and a scratch was drawn on each well using a p200 pipette tip. After two more washes with PBS to remove cell debris, the following cell culture media were added: DMEM supplemented with 1% FBS containing either no ethanol or 0.5% v/v ethanol. Each well was photographed at the time of treatment (0h) and after 9 h of incubation at ×40. The difference in gap distance was measured to quantify cell motility. Each experiment was repeated three times with each group having 6 wells per experiment (n=3).

Soft-agar colony formation assay. Soft-agar colony formation assay was used to determine the effect of ethanol on the ability of B16-BL6 melanoma to grow in an anchorage-independent manner (28). Cancer cells with a higher ability to grow in an anchorage-independent manner have a higher propensity to metastasize (29). Briefly, a 24-well plate was plated with 500 μl of DMEM containing 20% FBS and 1% agar. The bottom agar was allowed to solidify at room temperature, and the plate was stored at 4°C for less than one week before use.

During this time, B16-BL6 cells were grown to 70% confluency, washed with PBS twice, FBS-starved for 24 h, and then treated with or without 0.5% ethanol in DMEM supplemented with 1% FBS for 24 h. Subsequently, the cells were harvested using trypsin and counted. Meanwhile, the plate that was previously coated with 1% agar was allowed to warm to room temperature in an incubator. Then 1,000 B16-BL6 cells in a total volume of 500 μl of DMEM containing 10% FBS and 0.5% agar solution, with or without 0.5% v/v ethanol, were added to each well. Once the agar solidified, 200 μl of fresh DMEM containing 10% FBS, with or without 0.5% v/v ethanol, was added to the respective wells. The cell culture media (with or without ethanol) was replaced every day for one week. At the end of the week, three random fields from each well were photographed at ×40 and the number of visible colonies were counted. The experiment was carried out in triplicates: 3 wells for control and 3 wells for the 0.5% v/v ethanol treatment. The experiment was repeated three times (n=3).

RT² Profiler™ EMT PCR array. To determine the ability of ethanol to affect the epithelial or mesenchymal cell phenotype, we measured the expression of genes associated with EMT. The mouse EMT RT² Profiler PCR Array (no. PAMM-090; SA Biosciences, Frederick, MD, USA) measures the expression of 84 key genes that are increased or decreased during EMT. Details of each gene measured by our array can be found on the SA Bioscience website http://www.sabiosciences.com/rt_pcr_product/HTML/PAMM-090A.html. To obtain the RNA for our array, B16-BL6 cells were FBS-starved overnight and treated with DMEM or DMEM containing 0.5% v/v ethanol for 24 h. Cells were subsequently harvested using trypsin and pelleted by spinning for 5 min at 1,000 rpm at 4°C. After removing the supernatant, cell pellets were stored at −80°C before being transported to MD Anderson Science Park Molecular Biology Facility Core for mRNA extraction, cDNA synthesis, and RT² Profiler EMT PCR array analysis.

Briefly, cells were lysed in Qiagen's RLT lysis buffer and total RNA was extracted using the RNeasy Kit with optional DNaseI treatment (Qiagen, Valencia, CA, USA). An Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) was used to confirm RNA integrity. One microgram of total RNA was used as a template for cDNA synthesis using High Capacity cDNA Archive Kit (Applied Biosystems, Foster City, CA, USA). qRT-PCR was performed using ABI 7900HT Fast Real Time PCR System (Applied Biosystems) to analyze 84 genes related to EMT. Subsequent data analysis was performed using the Sequence Detection System software from ABI, version 2.2.2. Endogenous control products provided in the array such as β-glucuronidase (Gusb), hypoxanthine phosphoribosyltransferase 1 (Hprt1), heat shock protein 90 kDa alpha (cytosolic), class B member 1 (Hsp90ab1), glyceraldehyde 3-phosphate dehydrogenase (Gapdh), and β-actin (Actb) were averaged and used to calculate experimental Ct (cycle threshold). The ΔΔCt method was used to determine the amount of gene up- or down-regulation relative to genes expressed by non-ethanol treated B16-BL6 cell-derived RNA (1-fold). Four independent samples of no ethanol treatment (control) and ethanol treatment were compared for analysis (n=4).

Quantitative real-time PCR (qRT-PCR). To validate the array results for Snai1 and its target E-cadherin, qRT-PCR was performed. Total RNA was collected from cells that were serum starved overnight and then treated with control media or with 0.5% ethanol for 24 h. RNA was extracted using an RNeasy Mini Kit according to the manufacturer's instructions (Qiagen). Using 1 μg of RNA for each sample, reverse transcription was performed with High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). We also measured the expression of genes known to regulate Snai1, such as Il6 and Nfkb. Primers for 18S, Snai1, Il6, Nfkb, E-cadherin, Kiss1 and Nm23 (isoforms Nm23-m1 and Nm23-m2) were purchased from Integrated DNA Technologies (IDT, Coralville, IA, USA) and were as follows: 18S forward, F: GCATGGCCGTTCTTAGTTGGTGGA, backward, B: TCTCGGGTGGCTGAACGCCA; Il6 F: GCTGGTG ACAACCACGG CCT, B: AGCCTCCGACTTGTGAAGTGGT; Nfkb F: AGATC TTCTTGCTGTGCGACAA, B: GTGCCTCC CAGCCTGGT; Snai1 F: CACCTCCAGACCCACTCAGAT, B: CCTGAGTGGGGTGGGAGCT TCC; E-cadherin F: TTGAGGAGT TGAATGCTGAC, B: AGCTC GAACTTTCCAAGCAG; Kiss1 F: GCAAGCCTGGGT CTGCAGGG, B: CGACTGCGGGAGGCA CACAG; Nm23-m1 F: AGGACC AGTGGTTGCTATGG, B: CGCACAGCTCTTGTACTCCA; Nm23-m2 F: GGCCTCTG AAGAACACCTGA, B: GATGGTGCCTGGTTT TGAAT.

We used primers for the p65 subunit of Nfkb (RelA) because other studies have shown that it is up-regulated in many metastatic melanomas compared to normal melanocytes (30).

Quantitative RT-PCR was performed with a SYBR GreenER qPCR kit (Invitrogen) in a Mastercycler® ep Realplex Real-time PCR thermocycler (Eppendorf North America, Hauppauge, NY, USA). The relative expression levels of target genes were normalized to that of the housekeeping 18S rRNA. Amplification specificity was confirmed by melting curve analysis. Each gene was measured in quadruplicate and the average ΔCt was taken from the three wells before fold change was calculated using the ΔΔCt method. Analysis of at least three independent sets of samples w performed for each gene (n=3).

Immunofluorescence microscopy. To determine protein localization of Snai1 and E-cadherin, immunofluorescence microscopy was used. Wax pencils were used to mark a closed circle on microscope coverslips. B16-BL6 cells were plated into the circles and allowed to attach for 24 h before being FBS-starved overnight. They were subsequently treated with control DMEM or DMEM with 0.5% ethanol for 24 h. Cells were washed twice with PBS and fixed in 4% formalin/PBS for 10 min, then cells were subsequently washed twice with PBS before being stored in PBS at 4°C overnight. The next day, cells were permeabilized with 0.1% Triton-X100/PBS and neutralized with 100 μM glycine/PBS, before being treated with antibodies against Snai1 or E-cadherin (Cell Signaling, Danvars, MA, USA and Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA, respectively) and appropriate fluorescently-conjugated secondary antibodies (Cell Signaling, and Abcam, Cambridge, UK, respectively) as recommended by the manufacturer. After three washes with 0.2% Tween20 in PBS, cells were counterstained with two drops of 4’,6-diamidino-2-phenylindole (DAPI)/antifade (Millipore) according to the manufacturer's instructions for detection of cellular nuclei. After 15 min incubation, coverslips were placed onto microscope slides and sealed with nail polish, and images were taken with a Zeiss Axiovert 200 M fluorescent microscope at UT Austin's ICMB Core Facility. Images of control and experimental cells were acquired under identical exposure conditions for comparative analysis (n=3).

Statistical analysis. All experiments were analyzed for significance using the independent Student's t-test in SPSS (PAWS version 18; International Business Machines (IBM) Corporation, Armonk, NY, USA). P-values ≤0.05 were considered significant, and all data is represented as the mean±SEM.